\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123838334:

Variant ID: vg0123838334 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23838334
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TTACATGTTTTAGTGCAGTGTACTTTGCTACTGTAATCCATACTATGTTTAATTTTGGGTGTGTTTAGTTCACGCCAAAATTAGAAGTTTGGTTGAAATT[A/G]
AAACGATGTGACGGAAAAGTTGAAAGTTTATGTGTGTAGGAAAGTTTCGATGTGATAAAAAAAATTAGAAGTTTGAAGAAAAAAATTGGAACTAAACAAG

Reverse complement sequence

CTTGTTTAGTTCCAATTTTTTTCTTCAAACTTCTAATTTTTTTTATCACATCGAAACTTTCCTACACACATAAACTTTCAACTTTTCCGTCACATCGTTT[T/C]
AATTTCAACCAAACTTCTAATTTTGGCGTGAACTAAACACACCCAAAATTAAACATAGTATGGATTACAGTAGCAAAGTACACTGCACTAAAACATGTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 24.30% 0.61% 0.23% NA
All Indica  2759 96.70% 2.40% 0.58% 0.33% NA
All Japonica  1512 33.10% 66.30% 0.53% 0.07% NA
Aus  269 97.40% 1.50% 0.74% 0.37% NA
Indica I  595 96.30% 3.40% 0.17% 0.17% NA
Indica II  465 95.10% 2.60% 1.72% 0.65% NA
Indica III  913 99.50% 0.10% 0.22% 0.22% NA
Indica Intermediate  786 94.80% 4.20% 0.64% 0.38% NA
Temperate Japonica  767 7.00% 92.60% 0.39% 0.00% NA
Tropical Japonica  504 62.70% 36.90% 0.40% 0.00% NA
Japonica Intermediate  241 54.40% 44.00% 1.24% 0.41% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 62.20% 34.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123838334 A -> G LOC_Os01g42030.1 upstream_gene_variant ; 534.0bp to feature; MODIFIER silent_mutation Average:79.989; most accessible tissue: Zhenshan97 flower, score: 95.484 N N N N
vg0123838334 A -> G LOC_Os01g42040.1 upstream_gene_variant ; 4940.0bp to feature; MODIFIER silent_mutation Average:79.989; most accessible tissue: Zhenshan97 flower, score: 95.484 N N N N
vg0123838334 A -> G LOC_Os01g42050.1 downstream_gene_variant ; 2519.0bp to feature; MODIFIER silent_mutation Average:79.989; most accessible tissue: Zhenshan97 flower, score: 95.484 N N N N
vg0123838334 A -> G LOC_Os01g42024-LOC_Os01g42030 intergenic_region ; MODIFIER silent_mutation Average:79.989; most accessible tissue: Zhenshan97 flower, score: 95.484 N N N N
vg0123838334 A -> DEL N N silent_mutation Average:79.989; most accessible tissue: Zhenshan97 flower, score: 95.484 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123838334 A G -0.04 -0.06 -0.04 -0.02 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123838334 NA 1.66E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123838334 NA 2.79E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123838334 NA 1.97E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123838334 5.69E-06 1.93E-08 mr1471_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123838334 2.47E-06 NA mr1642_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123838334 NA 1.34E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123838334 NA 2.30E-18 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123838334 NA 4.96E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123838334 NA 4.18E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251