| Variant ID: vg0123461399 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23461399 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGGATCTCTGGGTAAAACACTTGGCGATCTTGTGTACCTGATATCAATTTTGTTCGAGAACCAGGTAGTAGTTGTAACTCAACCACTAGAAGTAAATGTA[C/T]
GAGAGATTGCTACGATTGACTGGTTGAGAACCAGTGAGTAGGTGTCTCTCGATCATTTGAAGTCGTGGTGTGAGGACCGCTGCGTTATTGCTGTAGTCGT
ACGACTACAGCAATAACGCAGCGGTCCTCACACCACGACTTCAAATGATCGAGAGACACCTACTCACTGGTTCTCAACCAGTCAATCGTAGCAATCTCTC[G/A]
TACATTTACTTCTAGTGGTTGAGTTACAACTACTACCTGGTTCTCGAACAAAATTGATATCAGGTACACAAGATCGCCAAGTGTTTTACCCAGAGATCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 9.30% | 2.48% | 16.67% | NA |
| All Indica | 2759 | 68.00% | 0.00% | 4.24% | 27.73% | NA |
| All Japonica | 1512 | 70.60% | 28.70% | 0.00% | 0.73% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 0.00% | 0.84% | 2.86% | NA |
| Indica II | 465 | 68.60% | 0.00% | 4.30% | 27.10% | NA |
| Indica III | 913 | 50.70% | 0.00% | 6.02% | 43.26% | NA |
| Indica Intermediate | 786 | 66.30% | 0.10% | 4.71% | 28.88% | NA |
| Temperate Japonica | 767 | 73.40% | 26.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.00% | 27.40% | 0.00% | 1.59% | NA |
| Japonica Intermediate | 241 | 60.60% | 38.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 4.40% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123461399 | C -> T | LOC_Os01g41450.1 | upstream_gene_variant ; 2337.0bp to feature; MODIFIER | silent_mutation | Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0123461399 | C -> T | LOC_Os01g41430.1 | downstream_gene_variant ; 3362.0bp to feature; MODIFIER | silent_mutation | Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0123461399 | C -> T | LOC_Os01g41440.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0123461399 | C -> DEL | N | N | silent_mutation | Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123461399 | NA | 4.70E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123461399 | 2.03E-06 | NA | mr1312_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123461399 | 1.04E-07 | 1.55E-09 | mr1363_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123461399 | 2.09E-06 | 8.25E-07 | mr1363_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123461399 | NA | 7.16E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123461399 | NA | 5.33E-06 | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123461399 | NA | 5.97E-09 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123461399 | NA | 1.57E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123461399 | 8.75E-08 | 8.73E-08 | mr1766_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123461399 | 3.29E-06 | NA | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |