Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0123461399:

Variant ID: vg0123461399 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23461399
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGATCTCTGGGTAAAACACTTGGCGATCTTGTGTACCTGATATCAATTTTGTTCGAGAACCAGGTAGTAGTTGTAACTCAACCACTAGAAGTAAATGTA[C/T]
GAGAGATTGCTACGATTGACTGGTTGAGAACCAGTGAGTAGGTGTCTCTCGATCATTTGAAGTCGTGGTGTGAGGACCGCTGCGTTATTGCTGTAGTCGT

Reverse complement sequence

ACGACTACAGCAATAACGCAGCGGTCCTCACACCACGACTTCAAATGATCGAGAGACACCTACTCACTGGTTCTCAACCAGTCAATCGTAGCAATCTCTC[G/A]
TACATTTACTTCTAGTGGTTGAGTTACAACTACTACCTGGTTCTCGAACAAAATTGATATCAGGTACACAAGATCGCCAAGTGTTTTACCCAGAGATCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	9.30%	2.48%	16.67%	NA
All Indica	2759	68.00%	0.00%	4.24%	27.73%	NA
All Japonica	1512	70.60%	28.70%	0.00%	0.73%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.30%	0.00%	0.84%	2.86%	NA
Indica II	465	68.60%	0.00%	4.30%	27.10%	NA
Indica III	913	50.70%	0.00%	6.02%	43.26%	NA
Indica Intermediate	786	66.30%	0.10%	4.71%	28.88%	NA
Temperate Japonica	767	73.40%	26.60%	0.00%	0.00%	NA
Tropical Japonica	504	71.00%	27.40%	0.00%	1.59%	NA
Japonica Intermediate	241	60.60%	38.20%	0.00%	1.24%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	4.40%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123461399	C -> T	LOC_Os01g41450.1	upstream_gene_variant ; 2337.0bp to feature; MODIFIER	silent_mutation	Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0123461399	C -> T	LOC_Os01g41430.1	downstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0123461399	C -> T	LOC_Os01g41440.1	intron_variant ; MODIFIER	silent_mutation	Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0123461399	C -> DEL	N	N	silent_mutation	Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123461399	NA	4.70E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399	2.03E-06	NA	mr1312_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399	1.04E-07	1.55E-09	mr1363_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399	2.09E-06	8.25E-07	mr1363_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399	NA	7.16E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399	NA	5.33E-06	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399	NA	5.97E-09	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399	NA	1.57E-06	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399	8.75E-08	8.73E-08	mr1766_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399	3.29E-06	NA	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251