\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123461399:

Variant ID: vg0123461399 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23461399
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGATCTCTGGGTAAAACACTTGGCGATCTTGTGTACCTGATATCAATTTTGTTCGAGAACCAGGTAGTAGTTGTAACTCAACCACTAGAAGTAAATGTA[C/T]
GAGAGATTGCTACGATTGACTGGTTGAGAACCAGTGAGTAGGTGTCTCTCGATCATTTGAAGTCGTGGTGTGAGGACCGCTGCGTTATTGCTGTAGTCGT

Reverse complement sequence

ACGACTACAGCAATAACGCAGCGGTCCTCACACCACGACTTCAAATGATCGAGAGACACCTACTCACTGGTTCTCAACCAGTCAATCGTAGCAATCTCTC[G/A]
TACATTTACTTCTAGTGGTTGAGTTACAACTACTACCTGGTTCTCGAACAAAATTGATATCAGGTACACAAGATCGCCAAGTGTTTTACCCAGAGATCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 9.30% 2.48% 16.67% NA
All Indica  2759 68.00% 0.00% 4.24% 27.73% NA
All Japonica  1512 70.60% 28.70% 0.00% 0.73% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.30% 0.00% 0.84% 2.86% NA
Indica II  465 68.60% 0.00% 4.30% 27.10% NA
Indica III  913 50.70% 0.00% 6.02% 43.26% NA
Indica Intermediate  786 66.30% 0.10% 4.71% 28.88% NA
Temperate Japonica  767 73.40% 26.60% 0.00% 0.00% NA
Tropical Japonica  504 71.00% 27.40% 0.00% 1.59% NA
Japonica Intermediate  241 60.60% 38.20% 0.00% 1.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 4.40% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123461399 C -> T LOC_Os01g41450.1 upstream_gene_variant ; 2337.0bp to feature; MODIFIER silent_mutation Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0123461399 C -> T LOC_Os01g41430.1 downstream_gene_variant ; 3362.0bp to feature; MODIFIER silent_mutation Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0123461399 C -> T LOC_Os01g41440.1 intron_variant ; MODIFIER silent_mutation Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0123461399 C -> DEL N N silent_mutation Average:20.392; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123461399 NA 4.70E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399 2.03E-06 NA mr1312_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399 1.04E-07 1.55E-09 mr1363_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399 2.09E-06 8.25E-07 mr1363_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399 NA 7.16E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399 NA 5.33E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399 NA 5.97E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399 NA 1.57E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399 8.75E-08 8.73E-08 mr1766_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123461399 3.29E-06 NA mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251