Variant ID: vg0123166741 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 23166741 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGTAGATCAATTTGGAATGGAGGGAATATGTTTTTTATTAAAAAAATTTCTATGGAAAAGTTGTTTGAAAAATCATATTAATTTATTTTTAATTTTTTTA[G/T]
CTAATATTTAATCAATCATGATATAACGAGTCATTCTGTTTTTCGTGTGGAAAGTATAAGTTCCCAACACATGTACAATAGAACACAGCCCTAAGCCTAA
TTAGGCTTAGGGCTGTGTTCTATTGTACATGTGTTGGGAACTTATACTTTCCACACGAAAAACAGAATGACTCGTTATATCATGATTGATTAAATATTAG[C/A]
TAAAAAAATTAAAAATAAATTAATATGATTTTTCAAACAACTTTTCCATAGAAATTTTTTTAATAAAAAACATATTCCCTCCATTCCAAATTGATCTACA
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.80% | 3.10% | 0.08% | 0.00% | NA |
All Indica | 2759 | 99.70% | 0.30% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 91.00% | 8.80% | 0.20% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 76.00% | 23.60% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0123166741 | G -> T | LOC_Os01g40940.1 | upstream_gene_variant ; 3247.0bp to feature; MODIFIER | silent_mutation | Average:34.843; most accessible tissue: Callus, score: 63.135 | N | N | N | N |
vg0123166741 | G -> T | LOC_Os01g40960.1 | upstream_gene_variant ; 4522.0bp to feature; MODIFIER | silent_mutation | Average:34.843; most accessible tissue: Callus, score: 63.135 | N | N | N | N |
vg0123166741 | G -> T | LOC_Os01g40950.1 | downstream_gene_variant ; 865.0bp to feature; MODIFIER | silent_mutation | Average:34.843; most accessible tissue: Callus, score: 63.135 | N | N | N | N |
vg0123166741 | G -> T | LOC_Os01g40940-LOC_Os01g40950 | intergenic_region ; MODIFIER | silent_mutation | Average:34.843; most accessible tissue: Callus, score: 63.135 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0123166741 | NA | 9.02E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0123166741 | NA | 7.76E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0123166741 | 1.20E-07 | 5.75E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0123166741 | 2.05E-07 | NA | mr1411 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0123166741 | 3.51E-06 | 3.51E-06 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0123166741 | 4.91E-06 | 1.83E-07 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0123166741 | NA | 9.64E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |