Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123011670:

Variant ID: vg0123011670 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23011670
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATCCTCCATTAATATTGATCTTGCATACCAGGATAACATGCCAAGTGCACGTGACATTTCTCAGCAATCTTCAATAGCATATAAAAAAGATGGGATCG[C/T]
CATCGCTCGACTCGAACTCACATAAAAACCAATCTTTTTCCTAGACCTACTCTACTAGAAAAACCATTTTTTCCCGACGATGTCATTTTTTTTCCAGGCG

Reverse complement sequence

CGCCTGGAAAAAAAATGACATCGTCGGGAAAAAATGGTTTTTCTAGTAGAGTAGGTCTAGGAAAAAGATTGGTTTTTATGTGAGTTCGAGTCGAGCGATG[G/A]
CGATCCCATCTTTTTTATATGCTATTGAAGATTGCTGAGAAATGTCACGTGCACTTGGCATGTTATCCTGGTATGCAAGATCAATATTAATGGAGGATCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 15.50% 0.00% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 53.50% 46.50% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 17.60% 82.40% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123011670 C -> T LOC_Os01g40720.1 upstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:59.168; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0123011670 C -> T LOC_Os01g40730.1 downstream_gene_variant ; 1754.0bp to feature; MODIFIER silent_mutation Average:59.168; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0123011670 C -> T LOC_Os01g40740.1 downstream_gene_variant ; 3837.0bp to feature; MODIFIER silent_mutation Average:59.168; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0123011670 C -> T LOC_Os01g40720-LOC_Os01g40730 intergenic_region ; MODIFIER silent_mutation Average:59.168; most accessible tissue: Minghui63 root, score: 73.73 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123011670 NA 9.68E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123011670 NA 9.55E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123011670 NA 3.68E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123011670 2.59E-06 1.23E-07 mr1826_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251