\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122872166:

Variant ID: vg0122872166 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22872166
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATCTGATCTGCTTGCTTGCTTTTTTTCTTTCGAGTATGTGTGCAGGTGATGCCGGTGTGATCTGAATTGTCGCCGACTCGTCGTCTTGCTGCTGCTGC[C/T]
GCTGCTTCTTCTTCCCGCCTTTTTTCACCTGCGTTCCCAACAGAGGCGGTTAAATAACTTCCACCAACCGCGCGCGGCGCCGGAAAGGAAAAAAAGAAGA

Reverse complement sequence

TCTTCTTTTTTTCCTTTCCGGCGCCGCGCGCGGTTGGTGGAAGTTATTTAACCGCCTCTGTTGGGAACGCAGGTGAAAAAAGGCGGGAAGAAGAAGCAGC[G/A]
GCAGCAGCAGCAAGACGACGAGTCGGCGACAATTCAGATCACACCGGCATCACCTGCACACATACTCGAAAGAAAAAAAGCAAGCAAGCAGATCAGATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 9.50% 1.04% 40.82% NA
All Indica  2759 48.50% 11.60% 1.52% 38.35% NA
All Japonica  1512 59.00% 2.10% 0.13% 38.82% NA
Aus  269 6.30% 0.40% 0.74% 92.57% NA
Indica I  595 6.40% 36.10% 1.51% 55.97% NA
Indica II  465 44.50% 2.20% 0.65% 52.69% NA
Indica III  913 79.80% 3.10% 1.42% 15.66% NA
Indica Intermediate  786 46.30% 8.70% 2.16% 42.88% NA
Temperate Japonica  767 95.80% 0.30% 0.00% 3.91% NA
Tropical Japonica  504 8.30% 1.20% 0.40% 90.08% NA
Japonica Intermediate  241 47.70% 9.50% 0.00% 42.74% NA
VI/Aromatic  96 5.20% 90.60% 1.04% 3.12% NA
Intermediate  90 54.40% 7.80% 2.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122872166 C -> T LOC_Os01g40480.1 upstream_gene_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:88.597; most accessible tissue: Zhenshan97 panicle, score: 96.173 N N N N
vg0122872166 C -> T LOC_Os01g40480-LOC_Os01g40499 intergenic_region ; MODIFIER silent_mutation Average:88.597; most accessible tissue: Zhenshan97 panicle, score: 96.173 N N N N
vg0122872166 C -> DEL N N silent_mutation Average:88.597; most accessible tissue: Zhenshan97 panicle, score: 96.173 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122872166 C T -0.06 -0.06 -0.06 0.0 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122872166 NA 7.72E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 7.05E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 5.61E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 9.88E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 2.25E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 7.91E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 2.72E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 8.53E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 6.01E-06 mr1405 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 6.11E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 6.92E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 1.11E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 2.11E-09 mr1629 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 4.71E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 3.63E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 1.56E-15 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 4.01E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 3.72E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 7.86E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 8.32E-06 mr1937 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 9.73E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 1.22E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 2.20E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 1.30E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 7.59E-08 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 3.24E-07 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 1.22E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122872166 NA 1.31E-08 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251