Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122865404:

Variant ID: vg0122865404 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22865404
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAAGCACGAGAATGATAAGGTTTGGTCTTTCAAACCTTATCATATAAAAATATATAATTTTGTATGGGTGCTAGCCGCGCAATTGCGCGGTAACAATC[C/T]
TATAGAGATTTTGGAGAAAAAATGGCAAGAGATCCAACCTCTTGAAAAATTTCCTATTGGTCAATCTCTCTCATTTGATTCATGTATTTTTTTCTACTGC

Reverse complement sequence

GCAGTAGAAAAAAATACATGAATCAAATGAGAGAGATTGACCAATAGGAAATTTTTCAAGAGGTTGGATCTCTTGCCATTTTTTCTCCAAAATCTCTATA[G/A]
GATTGTTACCGCGCAATTGCGCGGCTAGCACCCATACAAAATTATATATTTTTATATGATAAGGTTTGAAAGACCAAACCTTATCATTCTCGTGCTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	29.10%	0.15%	0.00%	NA
All Indica	2759	54.20%	45.60%	0.25%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	64.30%	35.70%	0.00%	0.00%	NA
Indica I	595	5.50%	94.30%	0.17%	0.00%	NA
Indica II	465	46.00%	54.00%	0.00%	0.00%	NA
Indica III	913	89.50%	10.30%	0.22%	0.00%	NA
Indica Intermediate	786	54.70%	44.80%	0.51%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122865404	C -> T	LOC_Os01g40480.1	downstream_gene_variant ; 3142.0bp to feature; MODIFIER	silent_mutation	Average:30.463; most accessible tissue: Zhenshan97 young leaf, score: 37.835	N	N	N	N
vg0122865404	C -> T	LOC_Os01g40470-LOC_Os01g40480	intergenic_region ; MODIFIER	silent_mutation	Average:30.463; most accessible tissue: Zhenshan97 young leaf, score: 37.835	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122865404	NA	6.20E-10	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	3.45E-06	mr1095	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	7.69E-07	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	4.76E-07	mr1123	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	2.04E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	2.34E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	3.00E-10	mr1220	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	1.08E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	5.94E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	2.49E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	4.22E-07	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	1.02E-07	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	3.64E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	5.80E-12	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	2.82E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	3.34E-08	mr1100_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	4.07E-11	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	1.35E-10	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	2.65E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	1.37E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122865404	NA	6.63E-11	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251