Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122819057:

Variant ID: vg0122819057 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22819057
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGATATTGGCAAAGAACAAAACAGATCCTACATCTGTGAACTGAGCAACCGGGGTGGCATCACTAGCACGTTGCGCACGTACTTACACTTGCACAGT[T/C]
TTATCTTCCACAACAAGAGTGAATAGCCAATGCGGTCTCTTAATTTTTTTTATGTTAGTTTAATCCCTGATTTTATATTGTCCAAACTCCAAATAAACCT

Reverse complement sequence

AGGTTTATTTGGAGTTTGGACAATATAAAATCAGGGATTAAACTAACATAAAAAAAATTAAGAGACCGCATTGGCTATTCACTCTTGTTGTGGAAGATAA[A/G]
ACTGTGCAAGTGTAAGTACGTGCGCAACGTGCTAGTGATGCCACCCCGGTTGCTCAGTTCACAGATGTAGGATCTGTTTTGTTCTTTGCCAATATCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.40%	10.70%	1.82%	0.06%	NA
All Indica	2759	99.50%	0.40%	0.07%	0.00%	NA
All Japonica	1512	62.80%	31.50%	5.42%	0.20%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	0.80%	0.25%	0.00%	NA
Temperate Japonica	767	90.20%	3.80%	6.00%	0.00%	NA
Tropical Japonica	504	26.00%	71.40%	1.98%	0.60%	NA
Japonica Intermediate	241	52.70%	36.50%	10.79%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	18.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122819057	T -> DEL	N	N	silent_mutation	Average:54.99; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0122819057	T -> C	LOC_Os01g40410.1	downstream_gene_variant ; 1148.0bp to feature; MODIFIER	silent_mutation	Average:54.99; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0122819057	T -> C	LOC_Os01g40420.1	downstream_gene_variant ; 1178.0bp to feature; MODIFIER	silent_mutation	Average:54.99; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0122819057	T -> C	LOC_Os01g40420.2	downstream_gene_variant ; 1163.0bp to feature; MODIFIER	silent_mutation	Average:54.99; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0122819057	T -> C	LOC_Os01g40420.3	downstream_gene_variant ; 1178.0bp to feature; MODIFIER	silent_mutation	Average:54.99; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0122819057	T -> C	LOC_Os01g40410-LOC_Os01g40420	intergenic_region ; MODIFIER	silent_mutation	Average:54.99; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122819057	NA	1.46E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	7.97E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	8.94E-10	mr1121	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	2.61E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	3.22E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	6.65E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	9.79E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	8.44E-20	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	4.97E-09	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	9.92E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	1.31E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	8.09E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	5.06E-31	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	7.18E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	6.67E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122819057	NA	1.56E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251