\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122697025:

Variant ID: vg0122697025 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22697025
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTTTTATGTAAATATAAAAAAATTTATGTCATACTTAAAGAACATTTGATGATGCATCAAGTCACCATAAAATAAATAATAATTATATAATTTTTTT[A/G]
AATAAAACGAATGGTCAAACGTTGGATAAAAAGTCAACAGCGTCATACATTAAAATATAAAATATAAGGTAGTATCAACCAAGCACACCATTAACAACAC

Reverse complement sequence

GTGTTGTTAATGGTGTGCTTGGTTGATACTACCTTATATTTTATATTTTAATGTATGACGCTGTTGACTTTTTATCCAACGTTTGACCATTCGTTTTATT[T/C]
AAAAAAATTATATAATTATTATTTATTTTATGGTGACTTGATGCATCATCAAATGTTCTTTAAGTATGACATAAATTTTTTTATATTTACATAAAAATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 1.30% 16.02% 5.86% NA
All Indica  2759 85.10% 0.90% 10.08% 3.91% NA
All Japonica  1512 77.80% 0.30% 14.75% 7.08% NA
Aus  269 8.20% 7.80% 63.57% 20.45% NA
Indica I  595 91.10% 0.50% 8.24% 0.17% NA
Indica II  465 89.20% 0.20% 4.95% 5.59% NA
Indica III  913 84.40% 1.00% 10.08% 4.49% NA
Indica Intermediate  786 79.00% 1.40% 14.50% 5.09% NA
Temperate Japonica  767 75.20% 0.00% 15.12% 9.65% NA
Tropical Japonica  504 77.80% 1.00% 17.46% 3.77% NA
Japonica Intermediate  241 86.30% 0.00% 7.88% 5.81% NA
VI/Aromatic  96 15.60% 10.40% 73.96% 0.00% NA
Intermediate  90 74.40% 2.20% 15.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122697025 A -> G LOC_Os01g40230.1 upstream_gene_variant ; 1396.0bp to feature; MODIFIER silent_mutation Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259 N N N N
vg0122697025 A -> G LOC_Os01g40210.1 downstream_gene_variant ; 3312.0bp to feature; MODIFIER silent_mutation Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259 N N N N
vg0122697025 A -> G LOC_Os01g40220.1 downstream_gene_variant ; 1359.0bp to feature; MODIFIER silent_mutation Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259 N N N N
vg0122697025 A -> G LOC_Os01g40220-LOC_Os01g40230 intergenic_region ; MODIFIER silent_mutation Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259 N N N N
vg0122697025 A -> DEL N N silent_mutation Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122697025 NA 3.12E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0122697025 NA 2.38E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 1.80E-06 mr1049 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 1.93E-07 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 1.41E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 8.26E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 3.34E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 1.72E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 2.42E-06 mr1127 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 6.86E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 4.87E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 7.01E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 6.65E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 6.02E-06 6.02E-06 mr1270 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 2.73E-06 2.73E-06 mr1275 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 9.55E-08 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 8.01E-07 8.01E-07 mr1331 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 1.62E-06 mr1363 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 2.71E-07 mr1371 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 5.52E-06 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 3.99E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 2.86E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 7.57E-06 7.57E-06 mr1529 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 3.99E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 1.11E-08 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 2.54E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 1.89E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 2.86E-12 mr1669 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 3.71E-06 2.03E-08 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 1.06E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 3.84E-06 3.84E-06 mr1674 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 9.97E-07 mr1689 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 5.27E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 9.15E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 2.37E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 8.12E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 8.04E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 5.38E-06 5.38E-06 mr1978 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025 NA 1.46E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251