Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122697025:

Variant ID: vg0122697025 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22697025
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATTTTTATGTAAATATAAAAAAATTTATGTCATACTTAAAGAACATTTGATGATGCATCAAGTCACCATAAAATAAATAATAATTATATAATTTTTTT[A/G]
AATAAAACGAATGGTCAAACGTTGGATAAAAAGTCAACAGCGTCATACATTAAAATATAAAATATAAGGTAGTATCAACCAAGCACACCATTAACAACAC

Reverse complement sequence

GTGTTGTTAATGGTGTGCTTGGTTGATACTACCTTATATTTTATATTTTAATGTATGACGCTGTTGACTTTTTATCCAACGTTTGACCATTCGTTTTATT[T/C]
AAAAAAATTATATAATTATTATTTATTTTATGGTGACTTGATGCATCATCAAATGTTCTTTAAGTATGACATAAATTTTTTTATATTTACATAAAAATTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.80%	1.30%	16.02%	5.86%	NA
All Indica	2759	85.10%	0.90%	10.08%	3.91%	NA
All Japonica	1512	77.80%	0.30%	14.75%	7.08%	NA
Aus	269	8.20%	7.80%	63.57%	20.45%	NA
Indica I	595	91.10%	0.50%	8.24%	0.17%	NA
Indica II	465	89.20%	0.20%	4.95%	5.59%	NA
Indica III	913	84.40%	1.00%	10.08%	4.49%	NA
Indica Intermediate	786	79.00%	1.40%	14.50%	5.09%	NA
Temperate Japonica	767	75.20%	0.00%	15.12%	9.65%	NA
Tropical Japonica	504	77.80%	1.00%	17.46%	3.77%	NA
Japonica Intermediate	241	86.30%	0.00%	7.88%	5.81%	NA
VI/Aromatic	96	15.60%	10.40%	73.96%	0.00%	NA
Intermediate	90	74.40%	2.20%	15.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122697025	A -> G	LOC_Os01g40230.1	upstream_gene_variant ; 1396.0bp to feature; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259	N	N	N	N
vg0122697025	A -> G	LOC_Os01g40210.1	downstream_gene_variant ; 3312.0bp to feature; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259	N	N	N	N
vg0122697025	A -> G	LOC_Os01g40220.1	downstream_gene_variant ; 1359.0bp to feature; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259	N	N	N	N
vg0122697025	A -> G	LOC_Os01g40220-LOC_Os01g40230	intergenic_region ; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259	N	N	N	N
vg0122697025	A -> DEL	N	N	silent_mutation	Average:47.647; most accessible tissue: Zhenshan97 root, score: 83.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122697025	NA	3.12E-17	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0122697025	NA	2.38E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	1.80E-06	mr1049	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	1.93E-07	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	1.41E-08	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	8.26E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	3.34E-06	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	1.72E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	2.42E-06	mr1127	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	6.86E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	4.87E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	7.01E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	6.65E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	6.02E-06	6.02E-06	mr1270	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	2.73E-06	2.73E-06	mr1275	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	9.55E-08	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	8.01E-07	8.01E-07	mr1331	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	1.62E-06	mr1363	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	2.71E-07	mr1371	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	5.52E-06	mr1375	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	3.99E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	2.86E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	7.57E-06	7.57E-06	mr1529	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	3.99E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	1.11E-08	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	2.54E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	1.89E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	2.86E-12	mr1669	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	3.71E-06	2.03E-08	mr1669	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	1.06E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	3.84E-06	3.84E-06	mr1674	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	9.97E-07	mr1689	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	5.27E-06	mr1716	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	9.15E-06	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	2.37E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	8.12E-06	mr1948	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	8.04E-06	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	5.38E-06	5.38E-06	mr1978	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697025	NA	1.46E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251