\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122663217:

Variant ID: vg0122663217 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22663217
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.23, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTTCAGCCATCGATCATTCGAAATTATATTGCGTCTGAAGAGTTCCAATTTGAGACCCAGTTTTGTTCTCTCTACATAGAGAAGTTTTATAGTGTTT[A/G]
CGAGGTACGTAGAGGTATTGAGAGGTAGAGTTCTGTGGACCGTTGATCGAGAGAGGGGTAAGGTACGGAATAAAATTATTGTAACCGATGGCGGTGGAGT

Reverse complement sequence

ACTCCACCGCCATCGGTTACAATAATTTTATTCCGTACCTTACCCCTCTCTCGATCAACGGTCCACAGAACTCTACCTCTCAATACCTCTACGTACCTCG[T/C]
AAACACTATAAAACTTCTCTATGTAGAGAGAACAAAACTGGGTCTCAAATTGGAACTCTTCAGACGCAATATAATTTCGAATGATCGATGGCTGAACATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 47.00% 0.02% 0.00% NA
All Indica  2759 33.80% 66.20% 0.04% 0.00% NA
All Japonica  1512 93.30% 6.70% 0.00% 0.00% NA
Aus  269 35.70% 64.30% 0.00% 0.00% NA
Indica I  595 1.80% 98.20% 0.00% 0.00% NA
Indica II  465 38.50% 61.50% 0.00% 0.00% NA
Indica III  913 52.50% 47.40% 0.11% 0.00% NA
Indica Intermediate  786 33.50% 66.50% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 81.90% 18.10% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122663217 A -> G LOC_Os01g40170.1 missense_variant ; p.Tyr963Cys; MODERATE nonsynonymous_codon ; Y963C Average:50.86; most accessible tissue: Callus, score: 84.484 unknown unknown TOLERATED 0.57

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122663217 NA 2.67E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 6.31E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 8.47E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 4.61E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 3.89E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 2.13E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 1.78E-08 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 1.50E-09 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 3.68E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 9.81E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 5.35E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 9.10E-10 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 5.86E-09 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 1.31E-12 mr1795_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217 NA 1.59E-12 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251