Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122663217:

Variant ID: vg0122663217 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22663217
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.23, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TATGTTCAGCCATCGATCATTCGAAATTATATTGCGTCTGAAGAGTTCCAATTTGAGACCCAGTTTTGTTCTCTCTACATAGAGAAGTTTTATAGTGTTT[A/G]
CGAGGTACGTAGAGGTATTGAGAGGTAGAGTTCTGTGGACCGTTGATCGAGAGAGGGGTAAGGTACGGAATAAAATTATTGTAACCGATGGCGGTGGAGT

Reverse complement sequence

ACTCCACCGCCATCGGTTACAATAATTTTATTCCGTACCTTACCCCTCTCTCGATCAACGGTCCACAGAACTCTACCTCTCAATACCTCTACGTACCTCG[T/C]
AAACACTATAAAACTTCTCTATGTAGAGAGAACAAAACTGGGTCTCAAATTGGAACTCTTCAGACGCAATATAATTTCGAATGATCGATGGCTGAACATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	47.00%	0.02%	0.00%	NA
All Indica	2759	33.80%	66.20%	0.04%	0.00%	NA
All Japonica	1512	93.30%	6.70%	0.00%	0.00%	NA
Aus	269	35.70%	64.30%	0.00%	0.00%	NA
Indica I	595	1.80%	98.20%	0.00%	0.00%	NA
Indica II	465	38.50%	61.50%	0.00%	0.00%	NA
Indica III	913	52.50%	47.40%	0.11%	0.00%	NA
Indica Intermediate	786	33.50%	66.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	81.90%	18.10%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122663217	A -> G	LOC_Os01g40170.1	missense_variant ; p.Tyr963Cys; MODERATE	nonsynonymous_codon ; Y963C	Average:50.86; most accessible tissue: Callus, score: 84.484	unknown	unknown	TOLERATED	0.57

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122663217	NA	2.67E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	6.31E-06	mr1123	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	8.47E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	4.61E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	3.89E-08	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	2.13E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	1.78E-08	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	1.50E-09	mr1100_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	3.68E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	9.81E-10	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	5.35E-06	mr1402_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	9.10E-10	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	5.86E-09	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	1.31E-12	mr1795_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122663217	NA	1.59E-12	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251