Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122531612:

Variant ID: vg0122531612 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22531612
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTACATCAAAATTGAAAGTTTGGTTGAAATTAGAACGACGTGATGGAAAAGTTGGAAGTTTATGTGTGTAGGAAAGTTTCGATATGATGAAAAAGTTG[A/G]
AAGTTTGAAGAAAAAGTTTGGAACTAAACAGGAGGTGTGGTTATCCAATACCGTCACTCTAATCTATTAGCACAATTATTTTATTACTTTTGAGCTAAAT

Reverse complement sequence

ATTTAGCTCAAAAGTAATAAAATAATTGTGCTAATAGATTAGAGTGACGGTATTGGATAACCACACCTCCTGTTTAGTTCCAAACTTTTTCTTCAAACTT[T/C]
CAACTTTTTCATCATATCGAAACTTTCCTACACACATAAACTTCCAACTTTTCCATCACGTCGTTCTAATTTCAACCAAACTTTCAATTTTGATGTAAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	21.30%	0.97%	25.48%	NA
All Indica	2759	53.90%	3.50%	0.94%	41.68%	NA
All Japonica	1512	40.10%	58.70%	1.06%	0.07%	NA
Aus	269	89.20%	0.40%	0.37%	10.04%	NA
Indica I	595	95.10%	0.30%	0.00%	4.54%	NA
Indica II	465	60.90%	1.70%	0.86%	36.56%	NA
Indica III	913	21.10%	7.20%	1.64%	69.99%	NA
Indica Intermediate	786	56.60%	2.50%	0.89%	39.95%	NA
Temperate Japonica	767	7.70%	91.50%	0.78%	0.00%	NA
Tropical Japonica	504	89.50%	9.10%	1.39%	0.00%	NA
Japonica Intermediate	241	40.20%	58.10%	1.24%	0.41%	NA
VI/Aromatic	96	88.50%	3.10%	0.00%	8.33%	NA
Intermediate	90	55.60%	21.10%	3.33%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122531612	A -> G	LOC_Os01g39950.1	upstream_gene_variant ; 2303.0bp to feature; MODIFIER	silent_mutation	Average:37.951; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0122531612	A -> G	LOC_Os01g39960.1	upstream_gene_variant ; 3387.0bp to feature; MODIFIER	silent_mutation	Average:37.951; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0122531612	A -> G	LOC_Os01g39940.1	downstream_gene_variant ; 2308.0bp to feature; MODIFIER	silent_mutation	Average:37.951; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0122531612	A -> G	LOC_Os01g39940-LOC_Os01g39950	intergenic_region ; MODIFIER	silent_mutation	Average:37.951; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0122531612	A -> DEL	N	N	silent_mutation	Average:37.951; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122531612	NA	9.21E-07	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	1.58E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	1.68E-06	mr1095	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	1.61E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	4.07E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	4.43E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	2.51E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	3.64E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	7.68E-09	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	3.62E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	8.65E-10	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	2.56E-09	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	2.94E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	9.42E-10	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	2.79E-07	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	3.65E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	2.69E-09	mr1096_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	4.20E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	3.60E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	1.51E-12	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	9.72E-08	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	7.22E-12	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122531612	NA	3.34E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251