\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122441794:

Variant ID: vg0122441794 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22441794
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.37, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCAATCTAAACAATCCACGTTCAAGTAAAGAGGATGAATCCGGGAGGTAAAAGAAAAAAAGAAAAAAAATCAAGGGGGACTCACAGGGAACCGATGAA[C/T]
CCTGGGAAGAGGAGGAGAGCGGCTCCGCCATGGCTGCCGTATGGCAGCGGCGGCGGCGGTGGCGTGCTCCGGATTGGATCGGAGGATTCCCGGGGGTGCC

Reverse complement sequence

GGCACCCCCGGGAATCCTCCGATCCAATCCGGAGCACGCCACCGCCGCCGCCGCTGCCATACGGCAGCCATGGCGGAGCCGCTCTCCTCCTCTTCCCAGG[G/A]
TTCATCGGTTCCCTGTGAGTCCCCCTTGATTTTTTTTCTTTTTTTCTTTTACCTCCCGGATTCATCCTCTTTACTTGAACGTGGATTGTTTAGATTGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 44.00% 0.04% 0.00% NA
All Indica  2759 40.40% 59.60% 0.04% 0.00% NA
All Japonica  1512 94.80% 5.20% 0.00% 0.00% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 4.70% 95.30% 0.00% 0.00% NA
Indica II  465 43.00% 57.00% 0.00% 0.00% NA
Indica III  913 59.60% 40.30% 0.11% 0.00% NA
Indica Intermediate  786 43.60% 56.40% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 86.30% 13.70% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 91.70% 1.04% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122441794 C -> T LOC_Os01g39790.1 missense_variant ; p.Gly11Asp; MODERATE nonsynonymous_codon ; G11D Average:88.433; most accessible tissue: Callus, score: 95.311 unknown unknown TOLERATED 0.58

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122441794 C T 0.02 0.03 0.05 0.01 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122441794 NA 7.45E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 2.30E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 8.17E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 3.10E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 5.95E-09 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 7.49E-08 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 5.22E-07 NA mr1875 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 1.29E-07 1.29E-07 mr1875 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 1.38E-08 NA mr1908 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 2.80E-07 1.29E-08 mr1908 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 3.06E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 1.12E-19 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 3.65E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 4.26E-11 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 1.61E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122441794 NA 5.07E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251