\
| Variant ID: vg0122377826 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22377826 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )
GATTTGTAGCCAGCTGTATTACAGACTCCAAGACGCAGTGTGTGTATGACAGGTGTGACCAGGTATTAATAGTGTAGTATGTAACTATTGTATGAATGAG[A/C,T]
CATTAGATTGGCTATAGATGAATTGGAGCTAGTAGTTGGCTATACTATTAAACTTGCGAGCAACAGATGTGGAGGAAGTCCCAACAAAATTTAGAGACAG
CTGTCTCTAAATTTTGTTGGGACTTCCTCCACATCTGTTGCTCGCAAGTTTAATAGTATAGCCAACTACTAGCTCCAATTCATCTATAGCCAATCTAATG[T/G,A]
CTCATTCATACAATAGTTACATACTACACTATTAATACCTGGTCACACCTGTCATACACACACTGCGTCTTGGAGTCTGTAATACAGCTGGCTACAAATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 35.80% | 0.70% | 9.78% | T: 0.08% |
| All Indica | 2759 | 75.30% | 7.10% | 1.20% | 16.27% | T: 0.11% |
| All Japonica | 1512 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.20% | 8.90% | 0.00% | 1.49% | T: 0.37% |
| Indica I | 595 | 97.00% | 0.30% | 0.34% | 2.35% | NA |
| Indica II | 465 | 92.30% | 2.20% | 0.00% | 5.59% | NA |
| Indica III | 913 | 53.60% | 14.10% | 2.30% | 29.68% | T: 0.33% |
| Indica Intermediate | 786 | 74.20% | 7.00% | 1.27% | 17.56% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 3.10% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 48.90% | 44.40% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122377826 | A -> T | LOC_Os01g39660.1 | upstream_gene_variant ; 4120.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> T | LOC_Os01g39680.1 | upstream_gene_variant ; 1233.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> T | LOC_Os01g39680.2 | upstream_gene_variant ; 1233.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> T | LOC_Os01g39680.3 | upstream_gene_variant ; 1233.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> T | LOC_Os01g39670.1 | downstream_gene_variant ; 266.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> T | LOC_Os01g39670-LOC_Os01g39680 | intergenic_region ; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> DEL | N | N | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> C | LOC_Os01g39660.1 | upstream_gene_variant ; 4120.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> C | LOC_Os01g39680.1 | upstream_gene_variant ; 1233.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> C | LOC_Os01g39680.2 | upstream_gene_variant ; 1233.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> C | LOC_Os01g39680.3 | upstream_gene_variant ; 1233.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> C | LOC_Os01g39670.1 | downstream_gene_variant ; 266.0bp to feature; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0122377826 | A -> C | LOC_Os01g39670-LOC_Os01g39680 | intergenic_region ; MODIFIER | silent_mutation | Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122377826 | NA | 5.46E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | NA | 8.46E-06 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | NA | 5.47E-07 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | NA | 4.15E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | NA | 1.76E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | 8.80E-07 | 8.80E-07 | mr1555 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | NA | 2.03E-07 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | NA | 1.24E-09 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | NA | 7.25E-06 | mr1943 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | NA | 3.46E-20 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122377826 | NA | 1.31E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |