\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122377826:

Variant ID: vg0122377826 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22377826
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTGTAGCCAGCTGTATTACAGACTCCAAGACGCAGTGTGTGTATGACAGGTGTGACCAGGTATTAATAGTGTAGTATGTAACTATTGTATGAATGAG[A/C,T]
CATTAGATTGGCTATAGATGAATTGGAGCTAGTAGTTGGCTATACTATTAAACTTGCGAGCAACAGATGTGGAGGAAGTCCCAACAAAATTTAGAGACAG

Reverse complement sequence

CTGTCTCTAAATTTTGTTGGGACTTCCTCCACATCTGTTGCTCGCAAGTTTAATAGTATAGCCAACTACTAGCTCCAATTCATCTATAGCCAATCTAATG[T/G,A]
CTCATTCATACAATAGTTACATACTACACTATTAATACCTGGTCACACCTGTCATACACACACTGCGTCTTGGAGTCTGTAATACAGCTGGCTACAAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 35.80% 0.70% 9.78% T: 0.08%
All Indica  2759 75.30% 7.10% 1.20% 16.27% T: 0.11%
All Japonica  1512 5.40% 94.60% 0.00% 0.00% NA
Aus  269 89.20% 8.90% 0.00% 1.49% T: 0.37%
Indica I  595 97.00% 0.30% 0.34% 2.35% NA
Indica II  465 92.30% 2.20% 0.00% 5.59% NA
Indica III  913 53.60% 14.10% 2.30% 29.68% T: 0.33%
Indica Intermediate  786 74.20% 7.00% 1.27% 17.56% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 13.30% 86.70% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 3.10% 0.00% 3.12% NA
Intermediate  90 48.90% 44.40% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122377826 A -> T LOC_Os01g39660.1 upstream_gene_variant ; 4120.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> T LOC_Os01g39680.1 upstream_gene_variant ; 1233.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> T LOC_Os01g39680.2 upstream_gene_variant ; 1233.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> T LOC_Os01g39680.3 upstream_gene_variant ; 1233.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> T LOC_Os01g39670.1 downstream_gene_variant ; 266.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> T LOC_Os01g39670-LOC_Os01g39680 intergenic_region ; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> DEL N N silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> C LOC_Os01g39660.1 upstream_gene_variant ; 4120.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> C LOC_Os01g39680.1 upstream_gene_variant ; 1233.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> C LOC_Os01g39680.2 upstream_gene_variant ; 1233.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> C LOC_Os01g39680.3 upstream_gene_variant ; 1233.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> C LOC_Os01g39670.1 downstream_gene_variant ; 266.0bp to feature; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0122377826 A -> C LOC_Os01g39670-LOC_Os01g39680 intergenic_region ; MODIFIER silent_mutation Average:65.051; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122377826 NA 5.46E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 NA 8.46E-06 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 NA 5.47E-07 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 NA 4.15E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 NA 1.76E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 8.80E-07 8.80E-07 mr1555 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 NA 2.03E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 NA 1.24E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 NA 7.25E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 NA 3.46E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122377826 NA 1.31E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251