\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122332434:

Variant ID: vg0122332434 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22332434
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGGGTAAATTTTTAGGGAATAATTTTACTTTAGATCCCTCTATTTGTTGCCCAGTCTAATTTTCGTCCTGAACCACAAAACCGGATATCGGATATGAC[C/T]
CTCCCCCAACTTACGAAAACCAGGCAAACGAGGTCTATCGGCGGTTTTGATAATGGTTTTGGTTGATGTGGCGCCTACGTGGCTAATTTTACTCAGTCTT

Reverse complement sequence

AAGACTGAGTAAAATTAGCCACGTAGGCGCCACATCAACCAAAACCATTATCAAAACCGCCGATAGACCTCGTTTGCCTGGTTTTCGTAAGTTGGGGGAG[G/A]
GTCATATCCGATATCCGGTTTTGTGGTTCAGGACGAAAATTAGACTGGGCAACAAATAGAGGGATCTAAAGTAAAATTATTCCCTAAAAATTTACCCTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 25.00% 0.36% 13.31% NA
All Indica  2759 38.20% 42.30% 0.43% 19.10% NA
All Japonica  1512 99.60% 0.20% 0.00% 0.20% NA
Aus  269 96.30% 0.40% 1.12% 2.23% NA
Indica I  595 3.90% 93.60% 0.17% 2.35% NA
Indica II  465 31.60% 63.00% 0.86% 4.52% NA
Indica III  913 57.00% 4.70% 0.22% 38.12% NA
Indica Intermediate  786 46.20% 34.90% 0.64% 18.32% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 16.70% 0.00% 1.04% 82.29% NA
Intermediate  90 71.10% 12.20% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122332434 C -> T LOC_Os01g39590.1 downstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:98.099; most accessible tissue: Zhenshan97 panicle, score: 99.394 N N N N
vg0122332434 C -> T LOC_Os01g39600.1 downstream_gene_variant ; 4912.0bp to feature; MODIFIER silent_mutation Average:98.099; most accessible tissue: Zhenshan97 panicle, score: 99.394 N N N N
vg0122332434 C -> T LOC_Os01g39600.2 downstream_gene_variant ; 4912.0bp to feature; MODIFIER silent_mutation Average:98.099; most accessible tissue: Zhenshan97 panicle, score: 99.394 N N N N
vg0122332434 C -> T LOC_Os01g39580-LOC_Os01g39590 intergenic_region ; MODIFIER silent_mutation Average:98.099; most accessible tissue: Zhenshan97 panicle, score: 99.394 N N N N
vg0122332434 C -> DEL N N silent_mutation Average:98.099; most accessible tissue: Zhenshan97 panicle, score: 99.394 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122332434 C T 0.0 0.0 0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122332434 NA 3.71E-51 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 1.25E-11 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 1.37E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 4.19E-07 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 3.68E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 3.37E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 9.24E-32 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 1.20E-21 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 5.05E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 5.42E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 1.10E-08 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 2.41E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 6.97E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 4.81E-07 NA mr1962 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 7.08E-12 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 8.78E-59 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 4.41E-12 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 7.73E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 3.86E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 1.07E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 6.62E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 3.16E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 1.05E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 2.37E-08 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122332434 NA 3.15E-10 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251