Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122149426:

Variant ID: vg0122149426 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22149426
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGCGGCTGGTCCGGTGCTAGCCTTCTCCTGGGCTTGTGTGTTGGCGATGTTGGTGTGTGGGTGGTGGTATTTTTTTTCTTTTTCCTGGTTACGGCCCTC[C/T]
AGGGTTATAATCTTGTAATTTTTTCCTGCTCTATCAATAGAACTTCGCACCGTCTCGTGCAAGTCGTTCAAAAAAAAAATCTTGTAGCCTGTGCATTGAG

Reverse complement sequence

CTCAATGCACAGGCTACAAGATTTTTTTTTTGAACGACTTGCACGAGACGGTGCGAAGTTCTATTGATAGAGCAGGAAAAAATTACAAGATTATAACCCT[G/A]
GAGGGCCGTAACCAGGAAAAAGAAAAAAAATACCACCACCCACACACCAACATCGCCAACACACAAGCCCAGGAGAAGGCTAGCACCGGACCAGCCGCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.10%	11.90%	0.00%	0.00%	NA
All Indica	2759	85.70%	14.30%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	45.70%	54.30%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	73.50%	26.50%	0.00%	0.00%	NA
Indica III	913	84.30%	15.70%	0.00%	0.00%	NA
Indica Intermediate	786	83.80%	16.20%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122149426	C -> T	LOC_Os01g39360.1	upstream_gene_variant ; 2788.0bp to feature; MODIFIER	silent_mutation	Average:69.53; most accessible tissue: Zhenshan97 flower, score: 81.724	N	N	N	N
vg0122149426	C -> T	LOC_Os01g39340.1	downstream_gene_variant ; 4347.0bp to feature; MODIFIER	silent_mutation	Average:69.53; most accessible tissue: Zhenshan97 flower, score: 81.724	N	N	N	N
vg0122149426	C -> T	LOC_Os01g39350.1	downstream_gene_variant ; 678.0bp to feature; MODIFIER	silent_mutation	Average:69.53; most accessible tissue: Zhenshan97 flower, score: 81.724	N	N	N	N
vg0122149426	C -> T	LOC_Os01g39350-LOC_Os01g39360	intergenic_region ; MODIFIER	silent_mutation	Average:69.53; most accessible tissue: Zhenshan97 flower, score: 81.724	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122149426	NA	1.79E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	NA	2.83E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	NA	8.31E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	NA	3.48E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	NA	3.70E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	NA	4.47E-06	mr1471	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	NA	3.63E-06	mr1625	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	8.95E-07	3.52E-09	mr1684	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	NA	8.91E-09	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	NA	4.68E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149426	NA	7.89E-06	mr1981	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251