Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122135979:

Variant ID: vg0122135979 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22135979
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATCTCCAGGGACGGCGGCAGCGGCGGCGGCTCCAGGTGCGGCGGCGGCGGCTCCAGGTGCAGACATGGTGGACGACGAGACGACAACGAACAGAGCAG[A/C]
AGTCGAGAGCAGTCGTGCGGAAGCACTCCCTAAAAACCTGATCACCCGCCTACCCGGTGCAGATCTCAGGCTCGTTCCGATCTCTCGTGCGCGCAAGCGA

Reverse complement sequence

TCGCTTGCGCGCACGAGAGATCGGAACGAGCCTGAGATCTGCACCGGGTAGGCGGGTGATCAGGTTTTTAGGGAGTGCTTCCGCACGACTGCTCTCGACT[T/G]
CTGCTCTGTTCGTTGTCGTCTCGTCGTCCACCATGTCTGCACCTGGAGCCGCCGCCGCCGCACCTGGAGCCGCCGCCGCTGCCGCCGTCCCTGGAGATGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	9.40%	2.31%	3.87%	NA
All Indica	2759	90.20%	0.30%	3.26%	6.31%	NA
All Japonica	1512	71.80%	27.30%	0.86%	0.00%	NA
Aus	269	97.00%	0.00%	1.12%	1.86%	NA
Indica I	595	96.80%	0.00%	1.51%	1.68%	NA
Indica II	465	97.40%	0.40%	0.22%	1.94%	NA
Indica III	913	84.40%	0.10%	3.40%	12.05%	NA
Indica Intermediate	786	87.50%	0.50%	6.23%	5.73%	NA
Temperate Japonica	767	96.70%	3.00%	0.26%	0.00%	NA
Tropical Japonica	504	30.20%	68.70%	1.19%	0.00%	NA
Japonica Intermediate	241	79.70%	18.30%	2.07%	0.00%	NA
VI/Aromatic	96	94.80%	3.10%	1.04%	1.04%	NA
Intermediate	90	72.20%	22.20%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122135979	A -> DEL	N	N	silent_mutation	Average:62.694; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0122135979	A -> C	LOC_Os01g39320.1	upstream_gene_variant ; 33.0bp to feature; MODIFIER	silent_mutation	Average:62.694; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0122135979	A -> C	LOC_Os01g39330.1	upstream_gene_variant ; 2064.0bp to feature; MODIFIER	silent_mutation	Average:62.694; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0122135979	A -> C	LOC_Os01g39320-LOC_Os01g39330	intergenic_region ; MODIFIER	silent_mutation	Average:62.694; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122135979	NA	6.50E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	8.24E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	8.05E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	1.86E-08	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	8.45E-11	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	2.97E-08	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	6.60E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	1.48E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	2.90E-06	2.95E-11	mr1642	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	1.46E-08	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	1.45E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	2.23E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	4.60E-12	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	6.81E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	7.04E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979	NA	3.24E-12	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251