\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122135979:

Variant ID: vg0122135979 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22135979
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCTCCAGGGACGGCGGCAGCGGCGGCGGCTCCAGGTGCGGCGGCGGCGGCTCCAGGTGCAGACATGGTGGACGACGAGACGACAACGAACAGAGCAG[A/C]
AGTCGAGAGCAGTCGTGCGGAAGCACTCCCTAAAAACCTGATCACCCGCCTACCCGGTGCAGATCTCAGGCTCGTTCCGATCTCTCGTGCGCGCAAGCGA

Reverse complement sequence

TCGCTTGCGCGCACGAGAGATCGGAACGAGCCTGAGATCTGCACCGGGTAGGCGGGTGATCAGGTTTTTAGGGAGTGCTTCCGCACGACTGCTCTCGACT[T/G]
CTGCTCTGTTCGTTGTCGTCTCGTCGTCCACCATGTCTGCACCTGGAGCCGCCGCCGCCGCACCTGGAGCCGCCGCCGCTGCCGCCGTCCCTGGAGATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 9.40% 2.31% 3.87% NA
All Indica  2759 90.20% 0.30% 3.26% 6.31% NA
All Japonica  1512 71.80% 27.30% 0.86% 0.00% NA
Aus  269 97.00% 0.00% 1.12% 1.86% NA
Indica I  595 96.80% 0.00% 1.51% 1.68% NA
Indica II  465 97.40% 0.40% 0.22% 1.94% NA
Indica III  913 84.40% 0.10% 3.40% 12.05% NA
Indica Intermediate  786 87.50% 0.50% 6.23% 5.73% NA
Temperate Japonica  767 96.70% 3.00% 0.26% 0.00% NA
Tropical Japonica  504 30.20% 68.70% 1.19% 0.00% NA
Japonica Intermediate  241 79.70% 18.30% 2.07% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 1.04% 1.04% NA
Intermediate  90 72.20% 22.20% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122135979 A -> DEL N N silent_mutation Average:62.694; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0122135979 A -> C LOC_Os01g39320.1 upstream_gene_variant ; 33.0bp to feature; MODIFIER silent_mutation Average:62.694; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0122135979 A -> C LOC_Os01g39330.1 upstream_gene_variant ; 2064.0bp to feature; MODIFIER silent_mutation Average:62.694; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0122135979 A -> C LOC_Os01g39320-LOC_Os01g39330 intergenic_region ; MODIFIER silent_mutation Average:62.694; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122135979 NA 6.50E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 8.24E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 8.05E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 1.86E-08 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 8.45E-11 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 2.97E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 6.60E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 1.48E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 2.90E-06 2.95E-11 mr1642 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 1.46E-08 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 1.45E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 2.23E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 4.60E-12 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 6.81E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 7.04E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122135979 NA 3.24E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251