Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121871143:

Variant ID: vg0121871143 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 21871143
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CCGAGAGATTCCTTCTCATTCTATCGGAAAGAGAGGATGTCTAATCAAAGATTAATTACACGGGTTAATGGAAAGAAAGCAAGGCAGAATTTGCACTTGA[G/C]
CTCCTCCCATTCACCGTGGAATTTCTTGACAGACATAGTGTACCATTGCTTCGCTCCATCTCTAAGAGAAAAAGGAAACAACTTCCACTTTATAGTTTCA

Reverse complement sequence

TGAAACTATAAAGTGGAAGTTGTTTCCTTTTTCTCTTAGAGATGGAGCGAAGCAATGGTACACTATGTCTGTCAAGAAATTCCACGGTGAATGGGAGGAG[C/G]
TCAAGTGCAAATTCTGCCTTGCTTTCTTTCCATTAACCCGTGTAATTAATCTTTGATTAGACATCCTCTCTTTCCGATAGAATGAGAAGGAATCTCTCGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.10%	8.50%	6.22%	29.24%	NA
All Indica	2759	28.90%	14.20%	9.89%	47.05%	NA
All Japonica	1512	99.60%	0.00%	0.00%	0.40%	NA
Aus	269	71.00%	1.10%	6.32%	21.56%	NA
Indica I	595	8.60%	5.90%	11.26%	74.29%	NA
Indica II	465	30.10%	17.40%	10.54%	41.94%	NA
Indica III	913	31.40%	19.50%	10.19%	38.88%	NA
Indica Intermediate	786	40.60%	12.30%	8.14%	38.93%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	90.60%	3.10%	1.04%	5.21%	NA
Intermediate	90	76.70%	3.30%	3.33%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0121871143	G -> DEL	N	N	silent_mutation	Average:14.209; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0121871143	G -> C	LOC_Os01g38940.1	upstream_gene_variant ; 4982.0bp to feature; MODIFIER	silent_mutation	Average:14.209; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0121871143	G -> C	LOC_Os01g38930.1	intron_variant ; MODIFIER	silent_mutation	Average:14.209; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0121871143	NA	1.65E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	6.67E-06	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	5.32E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	5.05E-08	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	3.02E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	3.24E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	1.17E-08	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	2.75E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	1.43E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	8.83E-06	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	2.13E-06	1.12E-07	mr1204_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	2.87E-06	6.52E-09	mr1250_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	9.86E-08	9.86E-08	mr1250_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	3.08E-06	mr1252_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	8.64E-06	mr1283_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	3.95E-06	mr1283_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	7.90E-06	7.90E-06	mr1372_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	2.22E-06	2.22E-06	mr1433_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	4.26E-06	4.26E-06	mr1516_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	7.98E-06	7.98E-06	mr1573_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	2.42E-06	mr1714_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	3.11E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	9.29E-06	mr1740_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	8.76E-06	mr1743_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	4.52E-06	mr1813_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	9.02E-06	9.02E-06	mr1869_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	1.23E-06	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121871143	NA	5.89E-08	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251