Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0121834497:

Variant ID: vg0121834497 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 21834497
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GTAATCAATTCATCTAATGATGCCATTTGTTTCAAGAATTTTGTGAGAAAGTAATATGATTATCAATTCTAATATCTTTCACTACCGAAACTCATAATAT[G/A]
TTACTATGCTCCAGTAGTAACATTGTTGTAAAAGTACAGTAACACGTGACGTTACTGTAGAATACATAGGACGTTACTGCACTTTTAGCAGTAACGTCGT

Reverse complement sequence

ACGACGTTACTGCTAAAAGTGCAGTAACGTCCTATGTATTCTACAGTAACGTCACGTGTTACTGTACTTTTACAACAATGTTACTACTGGAGCATAGTAA[C/T]
ATATTATGAGTTTCGGTAGTGAAAGATATTAGAATTGATAATCATATTACTTTCTCACAAAATTCTTGAAACAAATGGCATCATTAGATGAATTGATTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.70%	30.00%	2.48%	19.74%	NA
All Indica	2759	17.20%	49.70%	3.81%	29.32%	NA
All Japonica	1512	99.50%	0.30%	0.00%	0.20%	NA
Aus	269	47.20%	9.30%	4.09%	39.41%	NA
Indica I	595	1.00%	92.10%	0.84%	6.05%	NA
Indica II	465	24.10%	67.70%	2.37%	5.81%	NA
Indica III	913	14.20%	20.30%	5.91%	59.58%	NA
Indica Intermediate	786	28.90%	41.00%	4.45%	25.70%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.40%	0.00%	0.40%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	88.50%	2.10%	1.04%	8.33%	NA
Intermediate	90	72.20%	20.00%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0121834497	G -> A	LOC_Os01g38900.1	downstream_gene_variant ; 3129.0bp to feature; MODIFIER	silent_mutation	Average:20.763; most accessible tissue: Minghui63 young leaf, score: 27.355	N	N	N	N
vg0121834497	G -> A	LOC_Os01g38890-LOC_Os01g38900	intergenic_region ; MODIFIER	silent_mutation	Average:20.763; most accessible tissue: Minghui63 young leaf, score: 27.355	N	N	N	N
vg0121834497	G -> DEL	N	N	silent_mutation	Average:20.763; most accessible tissue: Minghui63 young leaf, score: 27.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0121834497	NA	1.08E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497	2.31E-06	NA	mr1029	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497	NA	3.22E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497	NA	7.96E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497	9.56E-06	6.51E-06	mr1471	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497	NA	6.18E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497	NA	4.26E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497	NA	1.16E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251