| Variant ID: vg0121834497 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 21834497 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 109. )
GTAATCAATTCATCTAATGATGCCATTTGTTTCAAGAATTTTGTGAGAAAGTAATATGATTATCAATTCTAATATCTTTCACTACCGAAACTCATAATAT[G/A]
TTACTATGCTCCAGTAGTAACATTGTTGTAAAAGTACAGTAACACGTGACGTTACTGTAGAATACATAGGACGTTACTGCACTTTTAGCAGTAACGTCGT
ACGACGTTACTGCTAAAAGTGCAGTAACGTCCTATGTATTCTACAGTAACGTCACGTGTTACTGTACTTTTACAACAATGTTACTACTGGAGCATAGTAA[C/T]
ATATTATGAGTTTCGGTAGTGAAAGATATTAGAATTGATAATCATATTACTTTCTCACAAAATTCTTGAAACAAATGGCATCATTAGATGAATTGATTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.70% | 30.00% | 2.48% | 19.74% | NA |
| All Indica | 2759 | 17.20% | 49.70% | 3.81% | 29.32% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.00% | 0.20% | NA |
| Aus | 269 | 47.20% | 9.30% | 4.09% | 39.41% | NA |
| Indica I | 595 | 1.00% | 92.10% | 0.84% | 6.05% | NA |
| Indica II | 465 | 24.10% | 67.70% | 2.37% | 5.81% | NA |
| Indica III | 913 | 14.20% | 20.30% | 5.91% | 59.58% | NA |
| Indica Intermediate | 786 | 28.90% | 41.00% | 4.45% | 25.70% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 88.50% | 2.10% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 72.20% | 20.00% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0121834497 | G -> A | LOC_Os01g38900.1 | downstream_gene_variant ; 3129.0bp to feature; MODIFIER | silent_mutation | Average:20.763; most accessible tissue: Minghui63 young leaf, score: 27.355 | N | N | N | N |
| vg0121834497 | G -> A | LOC_Os01g38890-LOC_Os01g38900 | intergenic_region ; MODIFIER | silent_mutation | Average:20.763; most accessible tissue: Minghui63 young leaf, score: 27.355 | N | N | N | N |
| vg0121834497 | G -> DEL | N | N | silent_mutation | Average:20.763; most accessible tissue: Minghui63 young leaf, score: 27.355 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0121834497 | NA | 1.08E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121834497 | 2.31E-06 | NA | mr1029 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121834497 | NA | 3.22E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121834497 | NA | 7.96E-07 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121834497 | 9.56E-06 | 6.51E-06 | mr1471 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121834497 | NA | 6.18E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121834497 | NA | 4.26E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121834497 | NA | 1.16E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |