\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121834497:

Variant ID: vg0121834497 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21834497
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTAATCAATTCATCTAATGATGCCATTTGTTTCAAGAATTTTGTGAGAAAGTAATATGATTATCAATTCTAATATCTTTCACTACCGAAACTCATAATAT[G/A]
TTACTATGCTCCAGTAGTAACATTGTTGTAAAAGTACAGTAACACGTGACGTTACTGTAGAATACATAGGACGTTACTGCACTTTTAGCAGTAACGTCGT

Reverse complement sequence

ACGACGTTACTGCTAAAAGTGCAGTAACGTCCTATGTATTCTACAGTAACGTCACGTGTTACTGTACTTTTACAACAATGTTACTACTGGAGCATAGTAA[C/T]
ATATTATGAGTTTCGGTAGTGAAAGATATTAGAATTGATAATCATATTACTTTCTCACAAAATTCTTGAAACAAATGGCATCATTAGATGAATTGATTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.70% 30.00% 2.48% 19.74% NA
All Indica  2759 17.20% 49.70% 3.81% 29.32% NA
All Japonica  1512 99.50% 0.30% 0.00% 0.20% NA
Aus  269 47.20% 9.30% 4.09% 39.41% NA
Indica I  595 1.00% 92.10% 0.84% 6.05% NA
Indica II  465 24.10% 67.70% 2.37% 5.81% NA
Indica III  913 14.20% 20.30% 5.91% 59.58% NA
Indica Intermediate  786 28.90% 41.00% 4.45% 25.70% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 2.10% 1.04% 8.33% NA
Intermediate  90 72.20% 20.00% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121834497 G -> A LOC_Os01g38900.1 downstream_gene_variant ; 3129.0bp to feature; MODIFIER silent_mutation Average:20.763; most accessible tissue: Minghui63 young leaf, score: 27.355 N N N N
vg0121834497 G -> A LOC_Os01g38890-LOC_Os01g38900 intergenic_region ; MODIFIER silent_mutation Average:20.763; most accessible tissue: Minghui63 young leaf, score: 27.355 N N N N
vg0121834497 G -> DEL N N silent_mutation Average:20.763; most accessible tissue: Minghui63 young leaf, score: 27.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121834497 NA 1.08E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497 2.31E-06 NA mr1029 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497 NA 3.22E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497 NA 7.96E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497 9.56E-06 6.51E-06 mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497 NA 6.18E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497 NA 4.26E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121834497 NA 1.16E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251