Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0121510990:

Variant ID: vg0121510990 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 21510990
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATAGCATTATAAGCATATTGTATAGGAGCAAAACTAGAAGTAGCATATGTATCTACACAATGATCATTAACCTTTTGAATAGCAAAGTATTGGTTGGG[T/C]
GAATCGGAGGTTACCTTTGGTGAAACTACAACTTGAGGTAGCGGGACGTTTTCTTTCACGACGCCTTGATCAGTCCTAATGTATTGTGTAGTAATATTGT

Reverse complement sequence

ACAATATTACTACACAATACATTAGGACTGATCAAGGCGTCGTGAAAGAAAACGTCCCGCTACCTCAAGTTGTAGTTTCACCAAAGGTAACCTCCGATTC[A/G]
CCCAACCAATACTTTGCTATTCAAAAGGTTAATGATCATTGTGTAGATACATATGCTACTTCTAGTTTTGCTCCTATACAATATGCTTATAATGCTATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.40%	0.10%	1.80%	50.74%	NA
All Indica	2759	21.70%	0.10%	2.90%	75.21%	NA
All Japonica	1512	97.60%	0.00%	0.07%	2.38%	NA
Aus	269	12.30%	0.00%	0.74%	86.99%	NA
Indica I	595	39.30%	0.00%	3.03%	57.65%	NA
Indica II	465	24.70%	0.00%	4.52%	70.75%	NA
Indica III	913	6.80%	0.10%	1.64%	91.46%	NA
Indica Intermediate	786	24.00%	0.40%	3.31%	72.26%	NA
Temperate Japonica	767	98.40%	0.00%	0.00%	1.56%	NA
Tropical Japonica	504	98.00%	0.00%	0.00%	1.98%	NA
Japonica Intermediate	241	93.80%	0.00%	0.41%	5.81%	NA
VI/Aromatic	96	70.80%	0.00%	1.04%	28.12%	NA
Intermediate	90	68.90%	1.10%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0121510990	T -> DEL	N	N	silent_mutation	Average:11.909; most accessible tissue: Callus, score: 43.271	N	N	N	N
vg0121510990	T -> C	LOC_Os01g38330.1	upstream_gene_variant ; 2346.0bp to feature; MODIFIER	silent_mutation	Average:11.909; most accessible tissue: Callus, score: 43.271	N	N	N	N
vg0121510990	T -> C	LOC_Os01g38340.1	downstream_gene_variant ; 3865.0bp to feature; MODIFIER	silent_mutation	Average:11.909; most accessible tissue: Callus, score: 43.271	N	N	N	N
vg0121510990	T -> C	LOC_Os01g38330-LOC_Os01g38340	intergenic_region ; MODIFIER	silent_mutation	Average:11.909; most accessible tissue: Callus, score: 43.271	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0121510990	5.11E-06	NA	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121510990	1.61E-06	NA	mr1803_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251