\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121510990:

Variant ID: vg0121510990 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21510990
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATAGCATTATAAGCATATTGTATAGGAGCAAAACTAGAAGTAGCATATGTATCTACACAATGATCATTAACCTTTTGAATAGCAAAGTATTGGTTGGG[T/C]
GAATCGGAGGTTACCTTTGGTGAAACTACAACTTGAGGTAGCGGGACGTTTTCTTTCACGACGCCTTGATCAGTCCTAATGTATTGTGTAGTAATATTGT

Reverse complement sequence

ACAATATTACTACACAATACATTAGGACTGATCAAGGCGTCGTGAAAGAAAACGTCCCGCTACCTCAAGTTGTAGTTTCACCAAAGGTAACCTCCGATTC[A/G]
CCCAACCAATACTTTGCTATTCAAAAGGTTAATGATCATTGTGTAGATACATATGCTACTTCTAGTTTTGCTCCTATACAATATGCTTATAATGCTATGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.40% 0.10% 1.80% 50.74% NA
All Indica  2759 21.70% 0.10% 2.90% 75.21% NA
All Japonica  1512 97.60% 0.00% 0.07% 2.38% NA
Aus  269 12.30% 0.00% 0.74% 86.99% NA
Indica I  595 39.30% 0.00% 3.03% 57.65% NA
Indica II  465 24.70% 0.00% 4.52% 70.75% NA
Indica III  913 6.80% 0.10% 1.64% 91.46% NA
Indica Intermediate  786 24.00% 0.40% 3.31% 72.26% NA
Temperate Japonica  767 98.40% 0.00% 0.00% 1.56% NA
Tropical Japonica  504 98.00% 0.00% 0.00% 1.98% NA
Japonica Intermediate  241 93.80% 0.00% 0.41% 5.81% NA
VI/Aromatic  96 70.80% 0.00% 1.04% 28.12% NA
Intermediate  90 68.90% 1.10% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121510990 T -> DEL N N silent_mutation Average:11.909; most accessible tissue: Callus, score: 43.271 N N N N
vg0121510990 T -> C LOC_Os01g38330.1 upstream_gene_variant ; 2346.0bp to feature; MODIFIER silent_mutation Average:11.909; most accessible tissue: Callus, score: 43.271 N N N N
vg0121510990 T -> C LOC_Os01g38340.1 downstream_gene_variant ; 3865.0bp to feature; MODIFIER silent_mutation Average:11.909; most accessible tissue: Callus, score: 43.271 N N N N
vg0121510990 T -> C LOC_Os01g38330-LOC_Os01g38340 intergenic_region ; MODIFIER silent_mutation Average:11.909; most accessible tissue: Callus, score: 43.271 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121510990 5.11E-06 NA mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121510990 1.61E-06 NA mr1803_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251