\
| Variant ID: vg0121419136 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 21419136 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 61. )
CTGTGTAGTCCTGCTCCACCATAGACGTTGTGCACCCTATCAACCCCCACGAACTGGTGCCACTACTGCCAATGCCGACCCGTGCACCACATGCCGCCGA[T/C]
GGTGCTCCCCACATCCTCCTCCCGCACCTCACTTGATCTACACCGTAACTGTCGTGGGCGTCGTCGCACGGTGTCCCCGCTCCGCTGCTGTCCTGACTGT
ACAGTCAGGACAGCAGCGGAGCGGGGACACCGTGCGACGACGCCCACGACAGTTACGGTGTAGATCAAGTGAGGTGCGGGAGGAGGATGTGGGGAGCACC[A/G]
TCGGCGGCATGTGGTGCACGGGTCGGCATTGGCAGTAGTGGCACCAGTTCGTGGGGGTTGATAGGGTGCACAACGTCTATGGTGGAGCAGGACTACACAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 5.90% | 1.59% | 56.22% | NA |
| All Indica | 2759 | 5.40% | 3.00% | 2.54% | 89.05% | NA |
| All Japonica | 1512 | 95.00% | 0.30% | 0.13% | 4.56% | NA |
| Aus | 269 | 4.10% | 65.40% | 1.12% | 29.37% | NA |
| Indica I | 595 | 3.90% | 2.00% | 1.68% | 92.44% | NA |
| Indica II | 465 | 9.00% | 5.40% | 2.80% | 82.80% | NA |
| Indica III | 913 | 2.30% | 2.00% | 2.52% | 93.21% | NA |
| Indica Intermediate | 786 | 7.90% | 3.70% | 3.05% | 85.37% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.13% | 3.91% | NA |
| Tropical Japonica | 504 | 95.20% | 0.20% | 0.00% | 4.56% | NA |
| Japonica Intermediate | 241 | 91.70% | 1.20% | 0.41% | 6.64% | NA |
| VI/Aromatic | 96 | 68.80% | 12.50% | 0.00% | 18.75% | NA |
| Intermediate | 90 | 58.90% | 3.30% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0121419136 | T -> DEL | N | N | silent_mutation | Average:15.966; most accessible tissue: Callus, score: 46.094 | N | N | N | N |
| vg0121419136 | T -> C | LOC_Os01g38229.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.966; most accessible tissue: Callus, score: 46.094 | N | N | N | N |
| vg0121419136 | T -> C | LOC_Os01g38229.4 | intron_variant ; MODIFIER | silent_mutation | Average:15.966; most accessible tissue: Callus, score: 46.094 | N | N | N | N |
| vg0121419136 | T -> C | LOC_Os01g38229.3 | intron_variant ; MODIFIER | silent_mutation | Average:15.966; most accessible tissue: Callus, score: 46.094 | N | N | N | N |
| vg0121419136 | T -> C | LOC_Os01g38229.2 | intron_variant ; MODIFIER | silent_mutation | Average:15.966; most accessible tissue: Callus, score: 46.094 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0121419136 | NA | 1.21E-28 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | 1.03E-08 | 1.24E-08 | mr1309 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | NA | 8.53E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | NA | 2.35E-23 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | 3.57E-06 | NA | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | NA | 2.18E-27 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | NA | 1.01E-14 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | NA | 3.86E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | NA | 5.15E-19 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | NA | 4.51E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121419136 | NA | 2.19E-23 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |