\
| Variant ID: vg0121366875 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 21366875 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 70. )
GCCGCCCTGTCCTCGTGGGAATGGCCCGAGTATATCTAGCCCCCAGCACGAGAACGGCCAAGTGAGAGGGATAGTCTGGAGTGCTTGCGCTGGTAGCCTT[A/G]
TGTGTTTACTGTGGAATTGACAGGCTTCACACCGCTGAACCATGTCGCATGCATCTTTAAGGGCGGTTGGCCAGAAGAACTCTTGTCGAAAAGCTTTTCC
GGAAAAGCTTTTCGACAAGAGTTCTTCTGGCCAACCGCCCTTAAAGATGCATGCGACATGGTTCAGCGGTGTGAAGCCTGTCAATTCCACAGTAAACACA[T/C]
AAGGCTACCAGCGCAAGCACTCCAGACTATCCCTCTCACTTGGCCGTTCTCGTGCTGGGGGCTAGATATACTCGGGCCATTCCCACGAGGACAGGGCGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.70% | 35.10% | 4.97% | 2.24% | NA |
| All Indica | 2759 | 86.80% | 2.80% | 6.92% | 3.41% | NA |
| All Japonica | 1512 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 79.90% | 2.20% | 14.50% | 3.35% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 75.30% | 3.70% | 12.69% | 8.39% | NA |
| Indica III | 913 | 92.80% | 1.60% | 4.93% | 0.66% | NA |
| Indica Intermediate | 786 | 77.90% | 4.80% | 11.07% | 6.23% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 57.80% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0121366875 | A -> G | LOC_Os01g38150.1 | missense_variant ; p.Ile735Thr; MODERATE | nonsynonymous_codon ; I735T | Average:34.117; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | benign |
-1.014 |
TOLERATED | 1.00 |
| vg0121366875 | A -> DEL | LOC_Os01g38150.1 | N | frameshift_variant | Average:34.117; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0121366875 | NA | 1.30E-28 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121366875 | 6.57E-06 | NA | mr1078 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121366875 | NA | 1.07E-28 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121366875 | 1.61E-06 | NA | mr1234 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121366875 | NA | 3.14E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121366875 | NA | 4.96E-16 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121366875 | NA | 3.72E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121366875 | NA | 9.58E-18 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121366875 | NA | 3.46E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |