\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121061296:

Variant ID: vg0121061296 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21061296
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCACACTAAGGTAGTAGTACATAATTGATTTAAAAATTATATTTAAGTTGACTAGGTATTTTTTTTTATATTTAAGTTTTAAAACTAATGTTGACTAG[G/T]
TTTTTTTTAAAAAAGAAACACCATAGGTCACCAATATCATAGGGAAGTGAGTTCTATGATATATATTTTTTCCCTGTCTTTATTGTTCATATCTAAGTAT

Reverse complement sequence

ATACTTAGATATGAACAATAAAGACAGGGAAAAAATATATATCATAGAACTCACTTCCCTATGATATTGGTGACCTATGGTGTTTCTTTTTTAAAAAAAA[C/A]
CTAGTCAACATTAGTTTTAAAACTTAAATATAAAAAAAAATACCTAGTCAACTTAAATATAATTTTTAAATCAATTATGTACTACTACCTTAGTGTGGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 18.50% 4.27% 2.07% NA
All Indica  2759 62.00% 31.20% 6.78% 0.00% NA
All Japonica  1512 92.90% 0.10% 0.66% 6.35% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 11.90% 67.90% 20.17% 0.00% NA
Indica II  465 47.70% 46.00% 6.24% 0.00% NA
Indica III  913 97.90% 1.60% 0.44% 0.00% NA
Indica Intermediate  786 66.70% 29.00% 4.33% 0.00% NA
Temperate Japonica  767 99.30% 0.00% 0.26% 0.39% NA
Tropical Japonica  504 95.20% 0.20% 0.40% 4.17% NA
Japonica Intermediate  241 67.20% 0.40% 2.49% 29.88% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 10.00% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121061296 G -> T LOC_Os01g37630.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:37.952; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0121061296 G -> T LOC_Os01g37660.1 upstream_gene_variant ; 4165.0bp to feature; MODIFIER silent_mutation Average:37.952; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0121061296 G -> T LOC_Os01g37650.1 downstream_gene_variant ; 1033.0bp to feature; MODIFIER silent_mutation Average:37.952; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0121061296 G -> T LOC_Os01g37630-LOC_Os01g37650 intergenic_region ; MODIFIER silent_mutation Average:37.952; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0121061296 G -> DEL N N silent_mutation Average:37.952; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121061296 NA 1.29E-47 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 7.78E-16 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 2.28E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 5.14E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 1.05E-07 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 3.94E-07 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 2.45E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 2.28E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 8.51E-07 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 1.38E-09 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 9.22E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 6.24E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 2.11E-06 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 5.41E-06 4.36E-07 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 6.06E-06 4.77E-07 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 2.02E-06 NA mr1861 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 2.83E-06 2.51E-11 mr1861 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 8.64E-08 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 4.21E-08 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 4.32E-09 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 2.01E-12 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 8.18E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 4.34E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 4.13E-11 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 1.48E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 7.12E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121061296 NA 7.61E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251