\
| Variant ID: vg0119842659 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 19842659 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACATGCATTTGGTACCGGCCCACGAGGAACCCCGATACTCGCTTGCGGCAAAGGATGATTACTGTATGTGGATTGAAAATATGGATGCTGTAAATTAGAA[T/C]
TAAAACCAACACTACAGCTGTTGCTATTAAGGTTTTGTGGACTTAACACTGGAATAATAGAATTAGTAGTGCTAGTTGAAACACTAGGTACAGAACTACC
GGTAGTTCTGTACCTAGTGTTTCAACTAGCACTACTAATTCTATTATTCCAGTGTTAAGTCCACAAAACCTTAATAGCAACAGCTGTAGTGTTGGTTTTA[A/G]
TTCTAATTTACAGCATCCATATTTTCAATCCACATACAGTAATCATCCTTTGCCGCAAGCGAGTATCGGGGTTCCTCGTGGGCCGGTACCAAATGCATGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.30% | 11.90% | 1.97% | 15.85% | NA |
| All Indica | 2759 | 52.70% | 19.90% | 2.94% | 24.47% | NA |
| All Japonica | 1512 | 98.20% | 0.70% | 0.07% | 0.99% | NA |
| Aus | 269 | 77.30% | 0.40% | 3.72% | 18.59% | NA |
| Indica I | 595 | 59.30% | 16.80% | 2.35% | 21.51% | NA |
| Indica II | 465 | 73.30% | 1.30% | 1.94% | 23.44% | NA |
| Indica III | 913 | 34.30% | 35.00% | 3.07% | 27.60% | NA |
| Indica Intermediate | 786 | 56.90% | 15.60% | 3.82% | 23.66% | NA |
| Temperate Japonica | 767 | 98.70% | 1.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.60% | 0.20% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.40% | 0.41% | 3.32% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 87.80% | 2.20% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0119842659 | T -> DEL | N | N | silent_mutation | Average:29.992; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| vg0119842659 | T -> C | LOC_Os01g35830.1 | downstream_gene_variant ; 2989.0bp to feature; MODIFIER | silent_mutation | Average:29.992; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| vg0119842659 | T -> C | LOC_Os01g35820.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.992; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0119842659 | NA | 9.38E-10 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119842659 | NA | 4.75E-06 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119842659 | 3.49E-06 | 5.35E-12 | mr1728 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119842659 | NA | 1.52E-07 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119842659 | NA | 5.05E-10 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119842659 | NA | 1.32E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119842659 | NA | 7.08E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |