\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119552600:

Variant ID: vg0119552600 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19552600
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTTTGCAGTCAAGTAACTTGCTCAAGAATGATAATCCGAGTGCTTCAATTTTTCCTGCTGAGGCCTTCCGAGTAACAAAAACGAAGACGGTAAAAGGC[G/A]
AAAAATAAAAAACATGGTGCATCGAATAGATGCACCTAATTAGGTGTAGCCCCCGACTATATGATTAGTTAAAAAACTAAACATGTAGTCAAGAACAAAA

Reverse complement sequence

TTTTGTTCTTGACTACATGTTTAGTTTTTTAACTAATCATATAGTCGGGGGCTACACCTAATTAGGTGCATCTATTCGATGCACCATGTTTTTTATTTTT[C/T]
GCCTTTTACCGTCTTCGTTTTTGTTACTCGGAAGGCCTCAGCAGGAAAAATTGAAGCACTCGGATTATCATTCTTGAGCAAGTTACTTGACTGCAAAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 3.40% 11.70% 0.91% NA
All Indica  2759 73.90% 5.70% 18.92% 1.52% NA
All Japonica  1512 99.10% 0.10% 0.86% 0.00% NA
Aus  269 96.70% 0.00% 3.35% 0.00% NA
Indica I  595 59.30% 8.70% 28.57% 3.36% NA
Indica II  465 66.90% 7.70% 25.16% 0.22% NA
Indica III  913 88.90% 1.20% 7.89% 1.97% NA
Indica Intermediate  786 71.50% 7.40% 20.74% 0.38% NA
Temperate Japonica  767 98.70% 0.00% 1.30% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 2.20% 10.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119552600 G -> A LOC_Os01g35330.1 upstream_gene_variant ; 2248.0bp to feature; MODIFIER silent_mutation Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0119552600 G -> A LOC_Os01g35330.2 upstream_gene_variant ; 2248.0bp to feature; MODIFIER silent_mutation Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0119552600 G -> A LOC_Os01g35320.1 downstream_gene_variant ; 4472.0bp to feature; MODIFIER silent_mutation Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0119552600 G -> A LOC_Os01g35330-LOC_Os01g35360 intergenic_region ; MODIFIER silent_mutation Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0119552600 G -> DEL N N silent_mutation Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119552600 1.50E-06 5.43E-09 mr1310_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119552600 NA 1.09E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251