Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0119552600:

Variant ID: vg0119552600 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19552600
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTTTGCAGTCAAGTAACTTGCTCAAGAATGATAATCCGAGTGCTTCAATTTTTCCTGCTGAGGCCTTCCGAGTAACAAAAACGAAGACGGTAAAAGGC[G/A]
AAAAATAAAAAACATGGTGCATCGAATAGATGCACCTAATTAGGTGTAGCCCCCGACTATATGATTAGTTAAAAAACTAAACATGTAGTCAAGAACAAAA

Reverse complement sequence

TTTTGTTCTTGACTACATGTTTAGTTTTTTAACTAATCATATAGTCGGGGGCTACACCTAATTAGGTGCATCTATTCGATGCACCATGTTTTTTATTTTT[C/T]
GCCTTTTACCGTCTTCGTTTTTGTTACTCGGAAGGCCTCAGCAGGAAAAATTGAAGCACTCGGATTATCATTCTTGAGCAAGTTACTTGACTGCAAAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.00%	3.40%	11.70%	0.91%	NA
All Indica	2759	73.90%	5.70%	18.92%	1.52%	NA
All Japonica	1512	99.10%	0.10%	0.86%	0.00%	NA
Aus	269	96.70%	0.00%	3.35%	0.00%	NA
Indica I	595	59.30%	8.70%	28.57%	3.36%	NA
Indica II	465	66.90%	7.70%	25.16%	0.22%	NA
Indica III	913	88.90%	1.20%	7.89%	1.97%	NA
Indica Intermediate	786	71.50%	7.40%	20.74%	0.38%	NA
Temperate Japonica	767	98.70%	0.00%	1.30%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	2.20%	10.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119552600	G -> A	LOC_Os01g35330.1	upstream_gene_variant ; 2248.0bp to feature; MODIFIER	silent_mutation	Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0119552600	G -> A	LOC_Os01g35330.2	upstream_gene_variant ; 2248.0bp to feature; MODIFIER	silent_mutation	Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0119552600	G -> A	LOC_Os01g35320.1	downstream_gene_variant ; 4472.0bp to feature; MODIFIER	silent_mutation	Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0119552600	G -> A	LOC_Os01g35330-LOC_Os01g35360	intergenic_region ; MODIFIER	silent_mutation	Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0119552600	G -> DEL	N	N	silent_mutation	Average:50.036; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119552600	1.50E-06	5.43E-09	mr1310_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119552600	NA	1.09E-06	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251