Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0119377829:

Variant ID: vg0119377829 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 19377829
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGTGGATAAGGATGGGGCGAGAGAGGAGTGGCTCGTCTTAGGATGGGTGTCGGTTTTAACTGAAAAGTGGCATCTATTTCTTTTGCCTACAAAGATGC[T/C]
GGTTATAGGGTAGGTCCCGTAGTTGGGATAGGGACTAAAATGCCGGTTTTAGTTTAGAACCGACATCTATATCTAACAGGGGTAATAGGTATCGGTTTTG

Reverse complement sequence

CAAAACCGATACCTATTACCCCTGTTAGATATAGATGTCGGTTCTAAACTAAAACCGGCATTTTAGTCCCTATCCCAACTACGGGACCTACCCTATAACC[A/G]
GCATCTTTGTAGGCAAAAGAAATAGATGCCACTTTTCAGTTAAAACCGACACCCATCCTAAGACGAGCCACTCCTCTCTCGCCCCATCCTTATCCACTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.10%	39.50%	0.36%	0.00%	NA
All Indica	2759	70.80%	28.90%	0.33%	0.00%	NA
All Japonica	1512	51.60%	48.10%	0.33%	0.00%	NA
Aus	269	8.20%	91.80%	0.00%	0.00%	NA
Indica I	595	92.90%	6.60%	0.50%	0.00%	NA
Indica II	465	51.00%	48.80%	0.22%	0.00%	NA
Indica III	913	71.90%	28.10%	0.00%	0.00%	NA
Indica Intermediate	786	64.40%	35.00%	0.64%	0.00%	NA
Temperate Japonica	767	36.00%	64.00%	0.00%	0.00%	NA
Tropical Japonica	504	67.70%	31.70%	0.60%	0.00%	NA
Japonica Intermediate	241	67.60%	31.50%	0.83%	0.00%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	48.90%	47.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0119377829	T -> C	LOC_Os01g35030.1	upstream_gene_variant ; 340.0bp to feature; MODIFIER	silent_mutation	Average:89.658; most accessible tissue: Zhenshan97 panicle, score: 95.951	N	N	N	N
vg0119377829	T -> C	LOC_Os01g35000-LOC_Os01g35030	intergenic_region ; MODIFIER	silent_mutation	Average:89.658; most accessible tissue: Zhenshan97 panicle, score: 95.951	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0119377829	T	C	-0.01	0.01	0.0	-0.01	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0119377829	NA	4.57E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	6.88E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	1.84E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	7.58E-07	mr1289	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	3.96E-06	3.97E-06	mr1396	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	5.65E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	1.22E-07	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	2.19E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	7.18E-08	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	2.35E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	1.04E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	1.01E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	1.23E-07	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	2.45E-06	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	3.29E-06	mr1550_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119377829	NA	4.27E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251