\
| Variant ID: vg0119052418 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 19052418 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGTGTCTTCATTATCACAAAACTACATATTTTAGCATTGTTAAAACCTGTAGTTTTGTGATAATGAAGACACTAAACCTGTAGTTTTGTGATAAAAGAA[G/T]
ACGCTAAATGTGTAGTTCTAGGATAAACGAATACACTATAGTTTTGTGAAACAAGTTCTTAAATATGTAGTTTTGTGATAGATTATACAAAGTACCTGTA
TACAGGTACTTTGTATAATCTATCACAAAACTACATATTTAAGAACTTGTTTCACAAAACTATAGTGTATTCGTTTATCCTAGAACTACACATTTAGCGT[C/A]
TTCTTTTATCACAAAACTACAGGTTTAGTGTCTTCATTATCACAAAACTACAGGTTTTAACAATGCTAAAATATGTAGTTTTGTGATAATGAAGACACTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 1.90% | 1.18% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.50% | 5.80% | 3.64% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 83.20% | 10.80% | 6.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0119052418 | G -> T | LOC_Os01g34550.1 | upstream_gene_variant ; 3810.0bp to feature; MODIFIER | silent_mutation | Average:19.257; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg0119052418 | G -> T | LOC_Os01g34540.1 | downstream_gene_variant ; 1481.0bp to feature; MODIFIER | silent_mutation | Average:19.257; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg0119052418 | G -> T | LOC_Os01g34530-LOC_Os01g34540 | intergenic_region ; MODIFIER | silent_mutation | Average:19.257; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0119052418 | NA | 4.94E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | 5.59E-06 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | NA | 3.94E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | 3.36E-06 | NA | mr1164_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | NA | 2.73E-07 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | NA | 5.47E-06 | mr1296_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | NA | 3.84E-06 | mr1358_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | NA | 7.87E-06 | mr1381_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | 1.36E-06 | 1.36E-06 | mr1571_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | NA | 2.96E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0119052418 | NA | 2.47E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |