Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119052418:

Variant ID: vg0119052418 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19052418
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGTGTCTTCATTATCACAAAACTACATATTTTAGCATTGTTAAAACCTGTAGTTTTGTGATAATGAAGACACTAAACCTGTAGTTTTGTGATAAAAGAA[G/T]
ACGCTAAATGTGTAGTTCTAGGATAAACGAATACACTATAGTTTTGTGAAACAAGTTCTTAAATATGTAGTTTTGTGATAGATTATACAAAGTACCTGTA

Reverse complement sequence

TACAGGTACTTTGTATAATCTATCACAAAACTACATATTTAAGAACTTGTTTCACAAAACTATAGTGTATTCGTTTATCCTAGAACTACACATTTAGCGT[C/A]
TTCTTTTATCACAAAACTACAGGTTTAGTGTCTTCATTATCACAAAACTACAGGTTTTAACAATGCTAAAATATGTAGTTTTGTGATAATGAAGACACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 1.90% 1.18% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 90.50% 5.80% 3.64% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 83.20% 10.80% 6.00% 0.00% NA
Tropical Japonica  504 98.80% 0.00% 1.19% 0.00% NA
Japonica Intermediate  241 96.70% 2.10% 1.24% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119052418 G -> T LOC_Os01g34550.1 upstream_gene_variant ; 3810.0bp to feature; MODIFIER silent_mutation Average:19.257; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0119052418 G -> T LOC_Os01g34540.1 downstream_gene_variant ; 1481.0bp to feature; MODIFIER silent_mutation Average:19.257; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0119052418 G -> T LOC_Os01g34530-LOC_Os01g34540 intergenic_region ; MODIFIER silent_mutation Average:19.257; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119052418 NA 4.94E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 5.59E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 NA 3.94E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 3.36E-06 NA mr1164_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 NA 2.73E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 NA 5.47E-06 mr1296_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 NA 3.84E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 NA 7.87E-06 mr1381_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 1.36E-06 1.36E-06 mr1571_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 NA 2.96E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119052418 NA 2.47E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251