\
| Variant ID: vg0118901136 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18901136 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGTGTGTGAGAGTTTGGTTGGCCTGATGTTGAATATTCCCGGGAAGACAAAGGACGGGTTGAACGCGCGCCTTGATCTACAGGACATGAATATTTGCAG[C/T]
GAACTCTAGCCCATACGAGATGCAGAGACAGGTAAAGTGTACCTCCCTCCAGCCTGCCACACACTGTCGAAGGATGAGAAGATCGCAATGTTATCATGCT
AGCATGATAACATTGCGATCTTCTCATCCTTCGACAGTGTGTGGCAGGCTGGAGGGAGGTACACTTTACCTGTCTCTGCATCTCGTATGGGCTAGAGTTC[G/A]
CTGCAAATATTCATGTCCTGTAGATCAAGGCGCGCGTTCAACCCGTCCTTTGTCTTCCCGGGAATATTCAACATCAGGCCAACCAAACTCTCACACACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.20% | 0.30% | 14.49% | 44.01% | NA |
| All Indica | 2759 | 7.90% | 0.40% | 19.54% | 72.09% | NA |
| All Japonica | 1512 | 94.80% | 0.00% | 2.98% | 2.18% | NA |
| Aus | 269 | 52.80% | 0.00% | 33.46% | 13.75% | NA |
| Indica I | 595 | 2.50% | 0.30% | 24.71% | 72.44% | NA |
| Indica II | 465 | 6.50% | 0.20% | 27.96% | 65.38% | NA |
| Indica III | 913 | 10.30% | 0.00% | 9.64% | 80.07% | NA |
| Indica Intermediate | 786 | 10.20% | 1.10% | 22.14% | 66.54% | NA |
| Temperate Japonica | 767 | 99.20% | 0.00% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 86.50% | 0.00% | 8.73% | 4.76% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 66.70% | 0.00% | 11.11% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118901136 | C -> T | LOC_Os01g34290.1 | missense_variant&splice_region_variant ; p.Ala339Val; MODERATE | nonsynonymous_codon ; A339V | Average:12.633; most accessible tissue: Callus, score: 17.978 | unknown | unknown | TOLERATED | 0.16 |
| vg0118901136 | C -> DEL | LOC_Os01g34290.1 | N | frameshift_variant | Average:12.633; most accessible tissue: Callus, score: 17.978 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118901136 | NA | 4.72E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 7.74E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 3.77E-16 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 1.81E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 2.09E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 5.91E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 2.42E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 2.57E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 1.44E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 1.12E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | NA | 4.29E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118901136 | 1.77E-06 | 1.83E-26 | mr1943 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |