\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118270990:

Variant ID: vg0118270990 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18270990
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGATCAAGCAGACGACGTTCACAAGGAATTATCCGTTAACAACCTTTTATCGAGTAGTCCAGCCATGGCCGGTGCTATGAGATAGGTCGCCGGTCTTC[G/A]
TTGGTAGGTTGGGCGCGACGACTCTGCATTTGTCGAGATCGTTCTCGATAATGCGGTGTAACTTGACCACAACCCACTCGAGTCCTCAATTGTTCCTAAA

Reverse complement sequence

TTTAGGAACAATTGAGGACTCGAGTGGGTTGTGGTCAAGTTACACCGCATTATCGAGAACGATCTCGACAAATGCAGAGTCGTCGCGCCCAACCTACCAA[C/T]
GAAGACCGGCGACCTATCTCATAGCACCGGCCATGGCTGGACTACTCGATAAAAGGTTGTTAACGGATAATTCCTTGTGAACGTCGTCTGCTTGATCACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 33.30% 1.18% 3.17% NA
All Indica  2759 44.00% 48.70% 1.96% 5.36% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 35.70% 63.90% 0.37% 0.00% NA
Indica I  595 9.90% 76.80% 2.86% 10.42% NA
Indica II  465 64.10% 31.20% 1.94% 2.80% NA
Indica III  913 53.60% 41.40% 0.99% 4.05% NA
Indica Intermediate  786 46.80% 46.20% 2.42% 4.58% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118270990 G -> A LOC_Os01g33160.1 downstream_gene_variant ; 3792.0bp to feature; MODIFIER silent_mutation Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0118270990 G -> A LOC_Os01g33180.1 downstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0118270990 G -> A LOC_Os01g33190.1 downstream_gene_variant ; 1493.0bp to feature; MODIFIER silent_mutation Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0118270990 G -> A LOC_Os01g33180-LOC_Os01g33190 intergenic_region ; MODIFIER silent_mutation Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0118270990 G -> DEL N N silent_mutation Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118270990 NA 1.23E-14 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 1.03E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 1.03E-12 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 4.47E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 1.05E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 2.94E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 5.46E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 5.12E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 7.94E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 2.95E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 6.66E-07 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 5.25E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 1.54E-06 mr1415_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 9.96E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 3.71E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 6.06E-18 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 5.47E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 2.47E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 1.37E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 6.73E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 3.11E-10 mr1837_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 5.98E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 1.31E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 8.51E-07 1.27E-08 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990 NA 3.07E-08 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251