Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118270990:

Variant ID: vg0118270990 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18270990
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGATCAAGCAGACGACGTTCACAAGGAATTATCCGTTAACAACCTTTTATCGAGTAGTCCAGCCATGGCCGGTGCTATGAGATAGGTCGCCGGTCTTC[G/A]
TTGGTAGGTTGGGCGCGACGACTCTGCATTTGTCGAGATCGTTCTCGATAATGCGGTGTAACTTGACCACAACCCACTCGAGTCCTCAATTGTTCCTAAA

Reverse complement sequence

TTTAGGAACAATTGAGGACTCGAGTGGGTTGTGGTCAAGTTACACCGCATTATCGAGAACGATCTCGACAAATGCAGAGTCGTCGCGCCCAACCTACCAA[C/T]
GAAGACCGGCGACCTATCTCATAGCACCGGCCATGGCTGGACTACTCGATAAAAGGTTGTTAACGGATAATTCCTTGTGAACGTCGTCTGCTTGATCACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	33.30%	1.18%	3.17%	NA
All Indica	2759	44.00%	48.70%	1.96%	5.36%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.00%	NA
Aus	269	35.70%	63.90%	0.37%	0.00%	NA
Indica I	595	9.90%	76.80%	2.86%	10.42%	NA
Indica II	465	64.10%	31.20%	1.94%	2.80%	NA
Indica III	913	53.60%	41.40%	0.99%	4.05%	NA
Indica Intermediate	786	46.80%	46.20%	2.42%	4.58%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	71.10%	25.60%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118270990	G -> A	LOC_Os01g33160.1	downstream_gene_variant ; 3792.0bp to feature; MODIFIER	silent_mutation	Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203	N	N	N	N
vg0118270990	G -> A	LOC_Os01g33180.1	downstream_gene_variant ; 265.0bp to feature; MODIFIER	silent_mutation	Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203	N	N	N	N
vg0118270990	G -> A	LOC_Os01g33190.1	downstream_gene_variant ; 1493.0bp to feature; MODIFIER	silent_mutation	Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203	N	N	N	N
vg0118270990	G -> A	LOC_Os01g33180-LOC_Os01g33190	intergenic_region ; MODIFIER	silent_mutation	Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203	N	N	N	N
vg0118270990	G -> DEL	N	N	silent_mutation	Average:44.897; most accessible tissue: Minghui63 flower, score: 60.203	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118270990	NA	1.23E-14	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	1.03E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	1.03E-12	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	4.47E-06	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	1.05E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	2.94E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	5.46E-07	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	5.12E-24	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	7.94E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	2.95E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	6.66E-07	mr1406_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	5.25E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	1.54E-06	mr1415_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	9.96E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	3.71E-06	mr1562_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	6.06E-18	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	5.47E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	2.47E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	1.37E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	6.73E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	3.11E-10	mr1837_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	5.98E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	1.31E-06	mr1876_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	8.51E-07	1.27E-08	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118270990	NA	3.07E-08	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251