\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117668024:

Variant ID: vg0117668024 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 17668024
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.52, A: 0.48, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATATAATGAGGTAAGTGCTTTTGAGGAAGCTAATAATATTTTGAGTGAAAAGAATAAGAAGTGTGAGAAGATGTATAGAAAACAGGAATTTATCATT[A/G]
AATCTCTTAAATCTGAAATTGCTAGATTAAAATCTCTTATTCCTAATGATGATGATTGCTCAAATTATGAGGTTTTAATGAATGAGATTTCAAAAATTAG

Reverse complement sequence

CTAATTTTTGAAATCTCATTCATTAAAACCTCATAATTTGAGCAATCATCATCATTAGGAATAAGAGATTTTAATCTAGCAATTTCAGATTTAAGAGATT[T/C]
AATGATAAATTCCTGTTTTCTATACATCTTCTCACACTTCTTATTCTTTTCACTCAAAATATTATTAGCTTCCTCAAAAGCACTTACCTCATTATATTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 38.20% 1.23% 0.00% NA
All Indica  2759 94.90% 3.70% 1.49% 0.00% NA
All Japonica  1512 2.40% 97.50% 0.07% 0.00% NA
Aus  269 61.70% 32.70% 5.58% 0.00% NA
Indica I  595 96.80% 1.80% 1.34% 0.00% NA
Indica II  465 92.30% 5.80% 1.94% 0.00% NA
Indica III  913 97.50% 1.50% 0.99% 0.00% NA
Indica Intermediate  786 91.90% 6.20% 1.91% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 94.80% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 44.40% 54.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0117668024 A -> G LOC_Os01g32250.1 intron_variant ; MODIFIER silent_mutation Average:20.122; most accessible tissue: Minghui63 flag leaf, score: 29.435 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0117668024 NA 8.38E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 4.44E-32 mr1298 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 7.33E-48 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 2.80E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 5.78E-26 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 1.92E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 7.79E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 1.42E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 1.57E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 1.58E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 2.38E-06 1.79E-52 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 1.30E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 7.36E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 2.60E-25 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 4.84E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 3.30E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 4.75E-14 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 2.57E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 9.42E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 1.41E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117668024 NA 4.88E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251