Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117290822:

Variant ID: vg0117290822 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 17290822
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CAACTTATCATTCGTATTCAACAACTATTGGAAATTCAGATTGCTTTTATCTTGTTCTTGCTTGTTTCTTCGATTTGCTTGCAGGAATAAGGTTGATTTG[T/C]
ACCGGCAAGATCAACAACCCATGGAGAGGTGTATCGATTGCTAAGGCGCAACGCAATGTCTTGTACGGTTGTAGTTGGGCCGTCAACGTGTCTCCCAAAT

Reverse complement sequence

ATTTGGGAGACACGTTGACGGCCCAACTACAACCGTACAAGACATTGCGTTGCGCCTTAGCAATCGATACACCTCTCCATGGGTTGTTGATCTTGCCGGT[A/G]
CAAATCAACCTTATTCCTGCAAGCAAATCGAAGAAACAAGCAAGAACAAGATAAAAGCAATCTGAATTTCCAATAGTTGTTGAATACGAATGATAAGTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.00%	15.40%	20.10%	28.57%	NA
All Indica	2759	22.10%	1.40%	30.59%	45.85%	NA
All Japonica	1512	51.40%	44.00%	2.38%	2.18%	NA
Aus	269	66.90%	1.10%	19.33%	12.64%	NA
Indica I	595	10.80%	0.70%	28.07%	60.50%	NA
Indica II	465	26.00%	1.50%	22.58%	49.89%	NA
Indica III	913	26.80%	1.20%	36.91%	35.05%	NA
Indica Intermediate	786	22.90%	2.30%	29.90%	44.91%	NA
Temperate Japonica	767	21.60%	74.60%	3.39%	0.39%	NA
Tropical Japonica	504	89.70%	4.20%	0.99%	5.16%	NA
Japonica Intermediate	241	66.00%	30.30%	2.07%	1.66%	NA
VI/Aromatic	96	95.80%	1.00%	3.12%	0.00%	NA
Intermediate	90	45.60%	17.80%	16.67%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0117290822	T -> DEL	N	N	silent_mutation	Average:10.356; most accessible tissue: Callus, score: 21.795	N	N	N	N
vg0117290822	T -> C	LOC_Os01g31590.1	downstream_gene_variant ; 3235.0bp to feature; MODIFIER	silent_mutation	Average:10.356; most accessible tissue: Callus, score: 21.795	N	N	N	N
vg0117290822	T -> C	LOC_Os01g31590-LOC_Os01g31610	intergenic_region ; MODIFIER	silent_mutation	Average:10.356; most accessible tissue: Callus, score: 21.795	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0117290822	NA	7.06E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0117290822	NA	2.90E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0117290822	NA	8.49E-13	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0117290822	NA	7.62E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	6.49E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	5.72E-06	2.19E-06	mr1318	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	7.54E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	5.17E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	3.10E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	9.33E-08	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	1.61E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	2.42E-06	3.07E-07	mr1788	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	6.37E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	2.38E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	1.07E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	1.30E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117290822	NA	9.94E-07	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251