\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117142011:

Variant ID: vg0117142011 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 17142011
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGTTCGGAGGAGAGAGATCGATCCGAATCGAACTCGAATCCACGAATTTCCAAACGAAATTAGCCGACGATTCCATAAGAGAAAAGATAGAGGGGATC[C/A]
CAGGGATCATGTCCCCTCTATTAATTTCACCAGAAACGGAAAGGGGCGGCTGGATTTGGAAGGAGACGGCGGCGCAGCTCGGCTAGGGTTCGGGCGGCGG

Reverse complement sequence

CCGCCGCCCGAACCCTAGCCGAGCTGCGCCGCCGTCTCCTTCCAAATCCAGCCGCCCCTTTCCGTTTCTGGTGAAATTAATAGAGGGGACATGATCCCTG[G/T]
GATCCCCTCTATCTTTTCTCTTATGGAATCGTCGGCTAATTTCGTTTGGAAATTCGTGGATTCGAGTTCGATTCGGATCGATCTCTCTCCTCCGAACCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 5.00% 7.19% 3.72% NA
All Indica  2759 80.10% 8.30% 11.53% 0.04% NA
All Japonica  1512 88.20% 0.10% 0.99% 10.65% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 55.50% 17.50% 27.06% 0.00% NA
Indica II  465 73.80% 12.50% 13.55% 0.22% NA
Indica III  913 97.90% 0.70% 1.42% 0.00% NA
Indica Intermediate  786 81.90% 7.80% 10.31% 0.00% NA
Temperate Japonica  767 82.80% 0.00% 1.56% 15.65% NA
Tropical Japonica  504 94.80% 0.40% 0.20% 4.56% NA
Japonica Intermediate  241 91.70% 0.00% 0.83% 7.47% NA
VI/Aromatic  96 87.50% 0.00% 2.08% 10.42% NA
Intermediate  90 85.60% 6.70% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0117142011 C -> A LOC_Os01g31320.1 upstream_gene_variant ; 4564.0bp to feature; MODIFIER silent_mutation Average:79.665; most accessible tissue: Minghui63 flag leaf, score: 94.073 N N N N
vg0117142011 C -> A LOC_Os01g31330.1 upstream_gene_variant ; 1954.0bp to feature; MODIFIER silent_mutation Average:79.665; most accessible tissue: Minghui63 flag leaf, score: 94.073 N N N N
vg0117142011 C -> A LOC_Os01g31340.1 downstream_gene_variant ; 492.0bp to feature; MODIFIER silent_mutation Average:79.665; most accessible tissue: Minghui63 flag leaf, score: 94.073 N N N N
vg0117142011 C -> A LOC_Os01g31330-LOC_Os01g31340 intergenic_region ; MODIFIER silent_mutation Average:79.665; most accessible tissue: Minghui63 flag leaf, score: 94.073 N N N N
vg0117142011 C -> DEL N N silent_mutation Average:79.665; most accessible tissue: Minghui63 flag leaf, score: 94.073 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0117142011 C A 0.0 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0117142011 2.71E-06 NA mr1842_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117142011 4.09E-07 NA mr1933_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251