Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0117018913:

Variant ID: vg0117018913 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 17018913
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

ACACCGGCCCACGGAGAGGATTACCCAAGCCTCGATCACTAGGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAACCAGCGTC[G/A]
GCCTTCCTCCGCAATCTTCTCGGAGAGGTCACCGGGCAACTACTCCACAAGCCGTCTAAGAGGCGGCAACCTCCATGAGTAACAAGCAATGACGCGGCTC

Reverse complement sequence

GAGCCGCGTCATTGCTTGTTACTCATGGAGGTTGCCGCCTCTTAGACGGCTTGTGGAGTAGTTGCCCGGTGACCTCTCCGAGAAGATTGCGGAGGAAGGC[C/T]
GACGCTGGTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCCTAGTGATCGAGGCTTGGGTAATCCTCTCCGTGGGCCGGTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	39.50%	0.00%	0.19%	NA
All Indica	2759	94.20%	5.40%	0.00%	0.33%	NA
All Japonica	1512	2.60%	97.40%	0.00%	0.00%	NA
Aus	269	61.30%	38.70%	0.00%	0.00%	NA
Indica I	595	99.20%	0.50%	0.00%	0.34%	NA
Indica II	465	85.40%	14.40%	0.00%	0.22%	NA
Indica III	913	98.20%	1.40%	0.00%	0.33%	NA
Indica Intermediate	786	91.10%	8.50%	0.00%	0.38%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	5.40%	94.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0117018913	G -> A	LOC_Os01g31110.1	downstream_gene_variant ; 2589.0bp to feature; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N
vg0117018913	G -> A	LOC_Os01g31120.1	downstream_gene_variant ; 2084.0bp to feature; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N
vg0117018913	G -> A	LOC_Os01g31110-LOC_Os01g31120	intergenic_region ; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N
vg0117018913	G -> DEL	N	N	silent_mutation	Average:59.58; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0117018913	NA	1.43E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913	8.32E-06	NA	mr1211	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913	NA	1.63E-15	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913	NA	1.60E-19	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913	NA	1.49E-12	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913	NA	6.81E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913	NA	6.81E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251