\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117018913:

Variant ID: vg0117018913 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 17018913
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ACACCGGCCCACGGAGAGGATTACCCAAGCCTCGATCACTAGGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAACCAGCGTC[G/A]
GCCTTCCTCCGCAATCTTCTCGGAGAGGTCACCGGGCAACTACTCCACAAGCCGTCTAAGAGGCGGCAACCTCCATGAGTAACAAGCAATGACGCGGCTC

Reverse complement sequence

GAGCCGCGTCATTGCTTGTTACTCATGGAGGTTGCCGCCTCTTAGACGGCTTGTGGAGTAGTTGCCCGGTGACCTCTCCGAGAAGATTGCGGAGGAAGGC[C/T]
GACGCTGGTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCCTAGTGATCGAGGCTTGGGTAATCCTCTCCGTGGGCCGGTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.50% 0.00% 0.19% NA
All Indica  2759 94.20% 5.40% 0.00% 0.33% NA
All Japonica  1512 2.60% 97.40% 0.00% 0.00% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 99.20% 0.50% 0.00% 0.34% NA
Indica II  465 85.40% 14.40% 0.00% 0.22% NA
Indica III  913 98.20% 1.40% 0.00% 0.33% NA
Indica Intermediate  786 91.10% 8.50% 0.00% 0.38% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 5.40% 94.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0117018913 G -> A LOC_Os01g31110.1 downstream_gene_variant ; 2589.0bp to feature; MODIFIER silent_mutation Average:59.58; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0117018913 G -> A LOC_Os01g31120.1 downstream_gene_variant ; 2084.0bp to feature; MODIFIER silent_mutation Average:59.58; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0117018913 G -> A LOC_Os01g31110-LOC_Os01g31120 intergenic_region ; MODIFIER silent_mutation Average:59.58; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0117018913 G -> DEL N N silent_mutation Average:59.58; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0117018913 NA 1.43E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913 8.32E-06 NA mr1211 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913 NA 1.63E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913 NA 1.60E-19 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913 NA 1.49E-12 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913 NA 6.81E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117018913 NA 6.81E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251