\
| Variant ID: vg0116932562 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16932562 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 204. )
AGTGCAACCAAACTAAATCACCCGGTTCAAGCTTAACCTCTTGCCTACCTTTACTACCAACAATTCTATACTTTTCAGTCATCTTTTCAATGTTGAGCTT[G/T]
GTTGACTCATGCATTTTCAAAATAAATTCAGCGCGTGCCTTAGCATCATGATGAACCCTCTCACTAGTAGGTAAAGGCAAAATATCAATTGGAGCACGAG
CTCGTGCTCCAATTGATATTTTGCCTTTACCTACTAGTGAGAGGGTTCATCATGATGCTAAGGCACGCGCTGAATTTATTTTGAAAATGCATGAGTCAAC[C/A]
AAGCTCAACATTGAAAAGATGACTGAAAAGTATAGAATTGTTGGTAGTAAAGGTAGGCAAGAGGTTAAGCTTGAACCGGGTGATTTAGTTTGGTTGCACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.90% | 2.20% | 16.36% | 28.59% | NA |
| All Indica | 2759 | 25.00% | 3.30% | 24.72% | 46.97% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.26% | 0.60% | NA |
| Aus | 269 | 53.20% | 4.50% | 29.37% | 13.01% | NA |
| Indica I | 595 | 29.90% | 5.90% | 19.16% | 45.04% | NA |
| Indica II | 465 | 28.80% | 1.30% | 15.27% | 54.62% | NA |
| Indica III | 913 | 14.00% | 3.10% | 33.73% | 49.18% | NA |
| Indica Intermediate | 786 | 31.70% | 2.90% | 24.05% | 41.35% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 0.00% | 0.60% | 1.79% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 80.00% | 0.00% | 8.89% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116932562 | G -> T | LOC_Os01g30970.1 | downstream_gene_variant ; 2842.0bp to feature; MODIFIER | silent_mutation | Average:6.553; most accessible tissue: Callus, score: 19.307 | N | N | N | N |
| vg0116932562 | G -> T | LOC_Os01g30980.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.553; most accessible tissue: Callus, score: 19.307 | N | N | N | N |
| vg0116932562 | G -> DEL | N | N | silent_mutation | Average:6.553; most accessible tissue: Callus, score: 19.307 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116932562 | NA | 3.87E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 6.34E-06 | mr1378 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 4.33E-07 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 7.82E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 3.97E-10 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | 1.58E-06 | 1.22E-11 | mr1728 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 1.41E-07 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 4.09E-11 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 2.77E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 5.22E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 2.14E-09 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 4.27E-06 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 1.29E-11 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 4.98E-06 | mr1728_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 1.04E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116932562 | NA | 3.56E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |