Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0116560231:

Variant ID: vg0116560231 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 16560231
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCCTGGCCATCATTAGGTATGCTGCCTCCTGATAGGCGTGATCTGCGGTGCCTCCAGATGCCTCAACCACCATGTTAGCGAGGCTGGTGCCCAAATAGC[A/C,T]
ATGAACCTCCAGACGAACACGGTGGGGAAGCTCGCCACTGAGCGGCGGAACGGTCGAGTACTCCGGCGCGTTGGGGTAGCCCACCACCAAGGTCATGCGA

Reverse complement sequence

TCGCATGACCTTGGTGGTGGGCTACCCCAACGCGCCGGAGTACTCGACCGTTCCGCCGCTCAGTGGCGAGCTTCCCCACCGTGTTCGTCTGGAGGTTCAT[T/G,A]
GCTATTTGGGCACCAGCCTCGCTAACATGGTGGTTGAGGCATCTGGAGGCACCGCAGATCACGCCTATCAGGAGGCAGCATACCTAATGATGGCCAGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 37.10% 0.06% 0.00% NA
All Indica  2759 97.20% 2.80% 0.07% 0.00% NA
All Japonica  1512 4.00% 96.00% 0.00% 0.00% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 5.20% 0.13% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 10.00% 90.00% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0116560231 A -> T LOC_Os01g29540.1 missense_variant ; p.Cys55Ser; MODERATE N Average:80.745; most accessible tissue: Zhenshan97 flag leaf, score: 94.905 N N N N
vg0116560231 A -> T LOC_Os01g29530.1 upstream_gene_variant ; 2419.0bp to feature; MODIFIER N Average:80.745; most accessible tissue: Zhenshan97 flag leaf, score: 94.905 N N N N
vg0116560231 A -> T LOC_Os01g29550.1 upstream_gene_variant ; 2538.0bp to feature; MODIFIER N Average:80.745; most accessible tissue: Zhenshan97 flag leaf, score: 94.905 N N N N
vg0116560231 A -> C LOC_Os01g29540.1 missense_variant ; p.Cys55Gly; MODERATE nonsynonymous_codon ; C55G Average:80.745; most accessible tissue: Zhenshan97 flag leaf, score: 94.905 probably damaging -3.722 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0116560231 A C 0.02 0.02 0.02 0.01 0.02 0.02
vg0116560231 A T 0.01 0.02 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0116560231 NA 4.91E-29 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 1.49E-51 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 2.27E-07 NA mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 4.16E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 4.77E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 3.33E-25 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 5.68E-06 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 3.17E-53 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 2.59E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 2.26E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 1.62E-51 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 7.89E-08 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 1.65E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 4.65E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 4.10E-14 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 9.44E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 1.03E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116560231 NA 9.49E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251