| Variant ID: vg0116413548 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16413548 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATGGTGGAAACCACAGATTACAAAGGGAATAGCAGAACTCGATGATACCGACGAGATCGTAGTCGAGTTGATTCGACTAGATCTCCCGGCGACTTGGCT[C/T]
TGACAAGCTTCGGCTTCGTAGGCTGTGGTGGATGTGTTGGCTCTGAGATTCGATGCCTTAGGTCCTTCCGAGGGGTCCCTTTTATATCGCAGGTCAACTG
CAGTTGACCTGCGATATAAAAGGGACCCCTCGGAAGGACCTAAGGCATCGAATCTCAGAGCCAACACATCCACCACAGCCTACGAAGCCGAAGCTTGTCA[G/A]
AGCCAAGTCGCCGGGAGATCTAGTCGAATCAACTCGACTACGATCTCGTCGGTATCATCGAGTTCTGCTATTCCCTTTGTAATCTGTGGTTTCCACCATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 7.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 91.70% | 8.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 52.40% | 47.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 93.10% | 6.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 87.70% | 12.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 93.80% | 6.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.70% | 9.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116413548 | C -> T | LOC_Os01g29270.1 | upstream_gene_variant ; 180.0bp to feature; MODIFIER | silent_mutation | Average:43.359; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg0116413548 | C -> T | LOC_Os01g29280.1 | upstream_gene_variant ; 1493.0bp to feature; MODIFIER | silent_mutation | Average:43.359; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg0116413548 | C -> T | LOC_Os01g29290.1 | upstream_gene_variant ; 4584.0bp to feature; MODIFIER | silent_mutation | Average:43.359; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg0116413548 | C -> T | LOC_Os01g29270-LOC_Os01g29280 | intergenic_region ; MODIFIER | silent_mutation | Average:43.359; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116413548 | NA | 3.23E-07 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413548 | NA | 9.10E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413548 | 1.70E-06 | 8.73E-09 | mr1043 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413548 | 2.24E-06 | 5.94E-07 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413548 | NA | 2.97E-06 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |