\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116413548:

Variant ID: vg0116413548 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 16413548
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGGTGGAAACCACAGATTACAAAGGGAATAGCAGAACTCGATGATACCGACGAGATCGTAGTCGAGTTGATTCGACTAGATCTCCCGGCGACTTGGCT[C/T]
TGACAAGCTTCGGCTTCGTAGGCTGTGGTGGATGTGTTGGCTCTGAGATTCGATGCCTTAGGTCCTTCCGAGGGGTCCCTTTTATATCGCAGGTCAACTG

Reverse complement sequence

CAGTTGACCTGCGATATAAAAGGGACCCCTCGGAAGGACCTAAGGCATCGAATCTCAGAGCCAACACATCCACCACAGCCTACGAAGCCGAAGCTTGTCA[G/A]
AGCCAAGTCGCCGGGAGATCTAGTCGAATCAACTCGACTACGATCTCGTCGGTATCATCGAGTTCTGCTATTCCCTTTGTAATCTGTGGTTTCCACCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 7.70% 0.13% 0.00% NA
All Indica  2759 91.70% 8.10% 0.18% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 52.40% 47.20% 0.37% 0.00% NA
Indica I  595 93.10% 6.60% 0.34% 0.00% NA
Indica II  465 87.70% 12.00% 0.22% 0.00% NA
Indica III  913 93.80% 6.10% 0.11% 0.00% NA
Indica Intermediate  786 90.70% 9.20% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0116413548 C -> T LOC_Os01g29270.1 upstream_gene_variant ; 180.0bp to feature; MODIFIER silent_mutation Average:43.359; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0116413548 C -> T LOC_Os01g29280.1 upstream_gene_variant ; 1493.0bp to feature; MODIFIER silent_mutation Average:43.359; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0116413548 C -> T LOC_Os01g29290.1 upstream_gene_variant ; 4584.0bp to feature; MODIFIER silent_mutation Average:43.359; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0116413548 C -> T LOC_Os01g29270-LOC_Os01g29280 intergenic_region ; MODIFIER silent_mutation Average:43.359; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0116413548 NA 3.23E-07 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116413548 NA 9.10E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116413548 1.70E-06 8.73E-09 mr1043 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116413548 2.24E-06 5.94E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116413548 NA 2.97E-06 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251