Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0116412234:

Variant ID: vg0116412234 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 16412234
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, C: 0.46, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

GCTTGAATGGCCCGTGAAGAGACATGATGCCGGGAACGGTTCTCGTTGTCTCGTGTGTGTCGTGCCTCTCGGCGGCCATTCAGGTGATCGAGGAGATCGC[A/C,T]
GGTGCCGCGAGGTGGAGGGGTGGCTCGATGAGGCGATTCCCGCCGTTCAGGGTTTTCACCATTAGCATCGCCAGTTGGTGGCTGTTCTGGGTGTGCTGCG

Reverse complement sequence

CGCAGCACACCCAGAACAGCCACCAACTGGCGATGCTAATGGTGAAAACCCTGAACGGCGGGAATCGCCTCATCGAGCCACCCCTCCACCTCGCGGCACC[T/G,A]
GCGATCTCCTCGATCACCTGAATGGCCGCCGAGAGGCACGACACACACGAGACAACGAGAACCGTTCCCGGCATCATGTCTCTTCACGGGCCATTCAAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.60%	37.10%	0.02%	0.21%	T: 0.02%
All Indica	2759	97.50%	2.50%	0.00%	0.00%	NA
All Japonica	1512	2.70%	97.20%	0.00%	0.13%	NA
Aus	269	67.70%	31.60%	0.37%	0.00%	T: 0.37%
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.80%	0.00%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	5.80%	94.00%	0.00%	0.20%	NA
Japonica Intermediate	241	2.10%	97.50%	0.00%	0.41%	NA
VI/Aromatic	96	6.20%	85.40%	0.00%	8.33%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0116412234	A -> T	LOC_Os01g29280.1	upstream_gene_variant ; 2807.0bp to feature; MODIFIER	silent_mutation	Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0116412234	A -> T	LOC_Os01g29270.1	intron_variant ; MODIFIER	silent_mutation	Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0116412234	A -> DEL	N	N	silent_mutation	Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0116412234	A -> C	LOC_Os01g29280.1	upstream_gene_variant ; 2807.0bp to feature; MODIFIER	silent_mutation	Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0116412234	A -> C	LOC_Os01g29270.1	intron_variant ; MODIFIER	silent_mutation	Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0116412234	NA	8.41E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.54E-40	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	4.30E-48	mr1519	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	5.41E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.20E-17	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	6.51E-06	NA	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	2.64E-06	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	3.19E-06	3.97E-62	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	2.28E-73	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	1.48E-07	3.00E-59	mr1090_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	3.50E-06	NA	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.43E-55	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	3.83E-57	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.91E-38	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.18E-20	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	2.62E-50	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	3.60E-58	mr1526_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.04E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	4.05E-20	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.18E-23	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	8.95E-15	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	2.01E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	5.84E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.59E-17	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.25E-31	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.10E-25	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234	NA	1.68E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251