\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116412234:

Variant ID: vg0116412234 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 16412234
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, C: 0.46, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTGAATGGCCCGTGAAGAGACATGATGCCGGGAACGGTTCTCGTTGTCTCGTGTGTGTCGTGCCTCTCGGCGGCCATTCAGGTGATCGAGGAGATCGC[A/C,T]
GGTGCCGCGAGGTGGAGGGGTGGCTCGATGAGGCGATTCCCGCCGTTCAGGGTTTTCACCATTAGCATCGCCAGTTGGTGGCTGTTCTGGGTGTGCTGCG

Reverse complement sequence

CGCAGCACACCCAGAACAGCCACCAACTGGCGATGCTAATGGTGAAAACCCTGAACGGCGGGAATCGCCTCATCGAGCCACCCCTCCACCTCGCGGCACC[T/G,A]
GCGATCTCCTCGATCACCTGAATGGCCGCCGAGAGGCACGACACACACGAGACAACGAGAACCGTTCCCGGCATCATGTCTCTTCACGGGCCATTCAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 37.10% 0.02% 0.21% T: 0.02%
All Indica  2759 97.50% 2.50% 0.00% 0.00% NA
All Japonica  1512 2.70% 97.20% 0.00% 0.13% NA
Aus  269 67.70% 31.60% 0.37% 0.00% T: 0.37%
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 94.00% 0.00% 0.20% NA
Japonica Intermediate  241 2.10% 97.50% 0.00% 0.41% NA
VI/Aromatic  96 6.20% 85.40% 0.00% 8.33% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0116412234 A -> T LOC_Os01g29280.1 upstream_gene_variant ; 2807.0bp to feature; MODIFIER silent_mutation Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0116412234 A -> T LOC_Os01g29270.1 intron_variant ; MODIFIER silent_mutation Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0116412234 A -> DEL N N silent_mutation Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0116412234 A -> C LOC_Os01g29280.1 upstream_gene_variant ; 2807.0bp to feature; MODIFIER silent_mutation Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0116412234 A -> C LOC_Os01g29270.1 intron_variant ; MODIFIER silent_mutation Average:54.498; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0116412234 NA 8.41E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.54E-40 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 4.30E-48 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 5.41E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.20E-17 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 6.51E-06 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 2.64E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 3.19E-06 3.97E-62 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 2.28E-73 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 1.48E-07 3.00E-59 mr1090_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 3.50E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.43E-55 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 3.83E-57 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.91E-38 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.18E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 2.62E-50 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 3.60E-58 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.04E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 4.05E-20 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.18E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 8.95E-15 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 2.01E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 5.84E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.59E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.25E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.10E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116412234 NA 1.68E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251