\
| Variant ID: vg0116398776 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16398776 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTAAAGATAAAGTCTTTAGTCCTAGCCGGAACTAAAGATTTTTGGGATCTTTAGTATCGGTTGGTGAAATCAACTTGGTAATAAAGATAATTTACTTTTT[A/G]
TATGTCTTTTTCCTCCTTCAGCCCGAGCTATTGCTGCCAAAGTAAAGGAACTAGGAGGAAGGGAGGTGCTGCCAAATTTTTTTGTGAAAATATTTTGGTG
CACCAAAATATTTTCACAAAAAAATTTGGCAGCACCTCCCTTCCTCCTAGTTCCTTTACTTTGGCAGCAATAGCTCGGGCTGAAGGAGGAAAAAGACATA[T/C]
AAAAAGTAAATTATCTTTATTACCAAGTTGATTTCACCAACCGATACTAAAGATCCCAAAAATCTTTAGTTCCGGCTAGGACTAAAGACTTTATCTTTAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 6.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.40% | 18.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.80% | 4.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 56.50% | 43.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116398776 | A -> G | LOC_Os01g29250.1 | upstream_gene_variant ; 1011.0bp to feature; MODIFIER | silent_mutation | Average:32.5; most accessible tissue: Callus, score: 54.55 | N | N | N | N |
| vg0116398776 | A -> G | LOC_Os01g29260.1 | upstream_gene_variant ; 1853.0bp to feature; MODIFIER | silent_mutation | Average:32.5; most accessible tissue: Callus, score: 54.55 | N | N | N | N |
| vg0116398776 | A -> G | LOC_Os01g29250-LOC_Os01g29260 | intergenic_region ; MODIFIER | silent_mutation | Average:32.5; most accessible tissue: Callus, score: 54.55 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116398776 | NA | 1.34E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116398776 | NA | 4.85E-06 | mr1603 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116398776 | NA | 6.92E-09 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116398776 | 2.66E-06 | NA | mr1583_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116398776 | NA | 3.75E-09 | mr1583_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116398776 | NA | 1.28E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116398776 | NA | 1.92E-07 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |