\
| Variant ID: vg0116188975 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16188975 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 117. )
CCTAGACACCTTAGGAAACCCTCTAGTACAAGAAAGAAACTTTACATAACCAATCGTACTAAATTTGGACTCCTTCCAAATTCGACTCCGCATCCCATAC[A/G]
CACACAATACCTCCATCGTTTGCCATATGGAATCTTCACCAACCACGTGCATCAACTCTAGCCTTAGTATCCCGCATGATATCTGACCACCACGGACATC
GATGTCCGTGGTGGTCAGATATCATGCGGGATACTAAGGCTAGAGTTGATGCACGTGGTTGGTGAAGATTCCATATGGCAAACGATGGAGGTATTGTGTG[T/C]
GTATGGGATGCGGAGTCGAATTTGGAAGGAGTCCAAATTTAGTACGATTGGTTATGTAAAGTTTCTTTCTTGTACTAGAGGGTTTCCTAAGGTGTCTAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.80% | 37.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.10% | 2.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 67.70% | 32.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 56.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116188975 | A -> G | LOC_Os01g28894.1 | downstream_gene_variant ; 3752.0bp to feature; MODIFIER | silent_mutation | Average:33.048; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| vg0116188975 | A -> G | LOC_Os01g28882.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.048; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116188975 | NA | 5.18E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 9.23E-26 | mr1731 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 1.63E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 3.79E-44 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | 4.63E-07 | 2.54E-10 | mr1568_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 6.49E-19 | mr1581_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 3.43E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 1.52E-19 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 8.72E-15 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 4.47E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 1.02E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 9.71E-11 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 4.12E-16 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 4.08E-17 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 1.46E-11 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 1.31E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 1.72E-11 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | 8.94E-06 | 3.22E-06 | mr1946_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | NA | 1.72E-11 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116188975 | 8.94E-06 | 3.22E-06 | mr1948_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |