\
| Variant ID: vg0116103237 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16103237 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGTCTATCCCTATAGTTCTATTAGCACTAAGCATGGCTAAGCATTAATGAATAAGACATCCCAAGTAATCCCAACCAGTGGTAATAGGGTATAAGACAAC[G/A]
ATATCACAAGAACTAAATGCATTAATAGGTTCTACCCATACACCATAAACCGACAATATTAATATCTAGGCAATACATGCATATATATATATATATATAT
ATATATATATATATATATATGCATGTATTGCCTAGATATTAATATTGTCGGTTTATGGTGTATGGGTAGAACCTATTAATGCATTTAGTTCTTGTGATAT[C/T]
GTTGTCTTATACCCTATTACCACTGGTTGGGATTACTTGGGATGTCTTATTCATTAATGCTTAGCCATGCTTAGTGCTAATAGAACTATAGGGATAGACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 10.30% | 1.90% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 63.30% | 31.20% | 5.56% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 39.50% | 51.90% | 8.60% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 1.80% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.10% | 26.60% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116103237 | G -> A | LOC_Os01g28750.1 | upstream_gene_variant ; 1508.0bp to feature; MODIFIER | silent_mutation | Average:38.596; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0116103237 | G -> A | LOC_Os01g28744.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.596; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116103237 | NA | 1.53E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0116103237 | NA | 9.12E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 5.50E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 9.08E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 3.71E-06 | mr1170 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 9.62E-07 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 2.49E-08 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 9.02E-08 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | 4.72E-07 | 2.14E-06 | mr1412 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 5.06E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 1.38E-07 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 8.50E-07 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 8.64E-08 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 3.87E-06 | mr1576 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | NA | 1.54E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116103237 | 4.87E-06 | NA | mr1789 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |