\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115958705:

Variant ID: vg0115958705 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15958705
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GACAGATTCAGGTTGGCGTGGTATATTCGTCAAGGTAGAGTTTGTTAGAGTTTGTTTCGAATATATATACATATAATTGATCGATTACAGTTTAGAACTT[G/A]
GAGTTATACTAGATACAGGAATAGAGTAATATTATATAGAAAAGAGCAAGACGCATCGATCGTGGTTTTGTCTTTATTTCAATCCAAGCTGAAGTACATC

Reverse complement sequence

GATGTACTTCAGCTTGGATTGAAATAAAGACAAAACCACGATCGATGCGTCTTGCTCTTTTCTATATAATATTACTCTATTCCTGTATCTAGTATAACTC[C/T]
AAGTTCTAAACTGTAATCGATCAATTATATGTATATATATTCGAAACAAACTCTAACAAACTCTACCTTGACGAATATACCACGCCAACCTGAATCTGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 20.50% 0.21% 0.00% NA
All Indica  2759 68.00% 31.60% 0.36% 0.00% NA
All Japonica  1512 97.70% 2.30% 0.00% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 62.50% 36.60% 0.84% 0.00% NA
Indica II  465 83.90% 16.10% 0.00% 0.00% NA
Indica III  913 59.10% 40.70% 0.11% 0.00% NA
Indica Intermediate  786 73.00% 26.50% 0.51% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115958705 G -> A LOC_Os01g28490.1 downstream_gene_variant ; 1628.0bp to feature; MODIFIER silent_mutation Average:56.773; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0115958705 G -> A LOC_Os01g28500.1 downstream_gene_variant ; 30.0bp to feature; MODIFIER silent_mutation Average:56.773; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg0115958705 G -> A LOC_Os01g28490-LOC_Os01g28500 intergenic_region ; MODIFIER silent_mutation Average:56.773; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115958705 2.38E-06 2.37E-06 mr1058_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115958705 NA 4.81E-06 mr1058_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115958705 NA 6.25E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115958705 4.00E-06 4.00E-06 mr1487_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115958705 3.08E-06 3.08E-06 mr1487_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115958705 NA 9.89E-06 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115958705 6.51E-06 6.51E-06 mr1905_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251