Variant ID: vg0115958705 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 15958705 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 99. )
GACAGATTCAGGTTGGCGTGGTATATTCGTCAAGGTAGAGTTTGTTAGAGTTTGTTTCGAATATATATACATATAATTGATCGATTACAGTTTAGAACTT[G/A]
GAGTTATACTAGATACAGGAATAGAGTAATATTATATAGAAAAGAGCAAGACGCATCGATCGTGGTTTTGTCTTTATTTCAATCCAAGCTGAAGTACATC
GATGTACTTCAGCTTGGATTGAAATAAAGACAAAACCACGATCGATGCGTCTTGCTCTTTTCTATATAATATTACTCTATTCCTGTATCTAGTATAACTC[C/T]
AAGTTCTAAACTGTAATCGATCAATTATATGTATATATATTCGAAACAAACTCTAACAAACTCTACCTTGACGAATATACCACGCCAACCTGAATCTGTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 79.30% | 20.50% | 0.21% | 0.00% | NA |
All Indica | 2759 | 68.00% | 31.60% | 0.36% | 0.00% | NA |
All Japonica | 1512 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
Aus | 269 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 62.50% | 36.60% | 0.84% | 0.00% | NA |
Indica II | 465 | 83.90% | 16.10% | 0.00% | 0.00% | NA |
Indica III | 913 | 59.10% | 40.70% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 73.00% | 26.50% | 0.51% | 0.00% | NA |
Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0115958705 | G -> A | LOC_Os01g28490.1 | downstream_gene_variant ; 1628.0bp to feature; MODIFIER | silent_mutation | Average:56.773; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
vg0115958705 | G -> A | LOC_Os01g28500.1 | downstream_gene_variant ; 30.0bp to feature; MODIFIER | silent_mutation | Average:56.773; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
vg0115958705 | G -> A | LOC_Os01g28490-LOC_Os01g28500 | intergenic_region ; MODIFIER | silent_mutation | Average:56.773; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0115958705 | 2.38E-06 | 2.37E-06 | mr1058_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0115958705 | NA | 4.81E-06 | mr1058_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0115958705 | NA | 6.25E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0115958705 | 4.00E-06 | 4.00E-06 | mr1487_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0115958705 | 3.08E-06 | 3.08E-06 | mr1487_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0115958705 | NA | 9.89E-06 | mr1711_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0115958705 | 6.51E-06 | 6.51E-06 | mr1905_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |