Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0115643577:

Variant ID: vg0115643577 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15643577
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.07, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCCACATAGTCACTAAAGCGATATGCCACACTGATATTCCAGTCCCAATTTTTCTTTTTTTCCTTCCCCTCTGTGTTGTCCTTATCTTATTTTGTCTT[T/G]
TTTTTTTCACACGAACATGAAGGAAGAAGAGAAGAAAAAGGGAGTACAAAATATAAAGAAAATAAATCTAACATTTGTGTGCAACATAGGATCCGAAGAG

Reverse complement sequence

CTCTTCGGATCCTATGTTGCACACAAATGTTAGATTTATTTTCTTTATATTTTGTACTCCCTTTTTCTTCTCTTCTTCCTTCATGTTCGTGTGAAAAAAA[A/C]
AAGACAAAATAAGATAAGGACAACACAGAGGGGAAGGAAAAAAAGAAAAATTGGGACTGGAATATCAGTGTGGCATATCGCTTTAGTGACTATGTGGCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.20%	39.90%	0.95%	0.97%	NA
All Indica	2759	90.40%	6.50%	1.52%	1.56%	NA
All Japonica	1512	2.50%	97.50%	0.00%	0.00%	NA
Aus	269	65.40%	32.70%	0.74%	1.12%	NA
Indica I	595	95.50%	3.40%	1.01%	0.17%	NA
Indica II	465	81.30%	16.10%	1.29%	1.29%	NA
Indica III	913	93.60%	1.60%	2.08%	2.63%	NA
Indica Intermediate	786	88.30%	8.80%	1.40%	1.53%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	5.20%	94.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	37.80%	61.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115643577	T -> G	LOC_Os01g27980.1	upstream_gene_variant ; 2939.0bp to feature; MODIFIER	silent_mutation	Average:21.176; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0115643577	T -> G	LOC_Os01g27990.1	upstream_gene_variant ; 1235.0bp to feature; MODIFIER	silent_mutation	Average:21.176; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0115643577	T -> G	LOC_Os01g27990.2	upstream_gene_variant ; 1235.0bp to feature; MODIFIER	silent_mutation	Average:21.176; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0115643577	T -> G	LOC_Os01g27980-LOC_Os01g27990	intergenic_region ; MODIFIER	silent_mutation	Average:21.176; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0115643577	T -> DEL	N	N	silent_mutation	Average:21.176; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115643577	NA	1.57E-08	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643577	NA	4.52E-13	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643577	NA	3.53E-19	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643577	NA	2.90E-23	mr1362_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643577	NA	1.89E-20	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643577	NA	1.09E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643577	NA	3.10E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643577	NA	1.05E-18	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643577	NA	2.39E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643577	NA	2.39E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251