| Variant ID: vg0115616063 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15616063 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGTGTGTTTGCTATGAAATTGACAAGCTTCACACCGTTGTACCATGTCGCAAGCGTCTTTGAGGGCAGTTGGCTAGAAAAATCCTTGTCGAAAGGCTTTT[C/T]
TGACCAATGTACGACCGGCGGCATGTGACCCACAGACCCCTTCGTGTATGTCGAGGAGGAGGTGTTTGCCGTCGTTGGACGAGACACATTTGTGAAGTAA
TTACTTCACAAATGTGTCTCGTCCAACGACGGCAAACACCTCCTCCTCGACATACACGAAGGGGTCTGTGGGTCACATGCCGCCGGTCGTACATTGGTCA[G/A]
AAAAGCCTTTCGACAAGGATTTTTCTAGCCAACTGCCCTCAAAGACGCTTGCGACATGGTACAACGGTGTGAAGCTTGTCAATTTCATAGCAAACACACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.60% | 4.70% | 4.17% | 47.50% | NA |
| All Indica | 2759 | 18.40% | 0.80% | 4.82% | 76.04% | NA |
| All Japonica | 1512 | 85.30% | 12.40% | 0.79% | 1.59% | NA |
| Aus | 269 | 48.30% | 0.40% | 18.22% | 33.09% | NA |
| Indica I | 595 | 15.30% | 0.20% | 4.71% | 79.83% | NA |
| Indica II | 465 | 27.50% | 1.30% | 3.44% | 67.74% | NA |
| Indica III | 913 | 12.40% | 0.00% | 5.59% | 82.04% | NA |
| Indica Intermediate | 786 | 22.30% | 1.80% | 4.83% | 71.12% | NA |
| Temperate Japonica | 767 | 99.20% | 0.30% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 59.70% | 34.70% | 1.98% | 3.57% | NA |
| Japonica Intermediate | 241 | 94.20% | 4.10% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 89.60% | 6.20% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 53.30% | 10.00% | 3.33% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115616063 | C -> T | LOC_Os01g27930.1 | downstream_gene_variant ; 1541.0bp to feature; MODIFIER | silent_mutation | Average:7.806; most accessible tissue: Callus, score: 29.606 | N | N | N | N |
| vg0115616063 | C -> T | LOC_Os01g27940.1 | downstream_gene_variant ; 2158.0bp to feature; MODIFIER | silent_mutation | Average:7.806; most accessible tissue: Callus, score: 29.606 | N | N | N | N |
| vg0115616063 | C -> T | LOC_Os01g27940.2 | downstream_gene_variant ; 2158.0bp to feature; MODIFIER | silent_mutation | Average:7.806; most accessible tissue: Callus, score: 29.606 | N | N | N | N |
| vg0115616063 | C -> T | LOC_Os01g27930-LOC_Os01g27940 | intergenic_region ; MODIFIER | silent_mutation | Average:7.806; most accessible tissue: Callus, score: 29.606 | N | N | N | N |
| vg0115616063 | C -> DEL | N | N | silent_mutation | Average:7.806; most accessible tissue: Callus, score: 29.606 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115616063 | NA | 1.04E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115616063 | NA | 6.70E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115616063 | NA | 1.82E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115616063 | 1.27E-06 | NA | mr1125_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115616063 | 5.46E-06 | NA | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |