Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0114889993:

Variant ID: vg0114889993 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14889993
Reference Allele: C	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, C: 0.13, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGGCTGCGTACGCTGCGAGTCCTGAGAAGAGGCCGGGTTTAGAATATTCGAGCCGATATAGCGTTAAAAAGTTTAGTGGTACTGCAGTCTAAGGAGAT[C/G,A]
TTAGGATTGCAGCCAATTCTTGTCTTACCAATTATTTGGTAGTTTTGAATAGTACTTGTTAAACCTTACCAATTACTTGCTCTATCCCTAAATATTTAAC

Reverse complement sequence

GTTAAATATTTAGGGATAGAGCAAGTAATTGGTAAGGTTTAACAAGTACTATTCAAAACTACCAAATAATTGGTAAGACAAGAATTGGCTGCAATCCTAA[G/C,T]
ATCTCCTTAGACTGCAGTACCACTAAACTTTTTAACGCTATATCGGCTCGAATATTCTAAACCCGGCCTCTTCTCAGGACTCGCAGCGTACGCAGCCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.60%	35.10%	0.44%	15.83%	A: 0.04%
All Indica	2759	75.00%	6.60%	0.43%	17.91%	NA
All Japonica	1512	0.40%	86.50%	0.60%	12.43%	A: 0.07%
Aus	269	45.40%	33.50%	0.00%	21.19%	NA
Indica I	595	66.20%	15.60%	1.51%	16.64%	NA
Indica II	465	83.00%	4.70%	0.22%	12.04%	NA
Indica III	913	72.90%	1.50%	0.00%	25.52%	NA
Indica Intermediate	786	79.40%	6.90%	0.25%	13.49%	NA
Temperate Japonica	767	0.10%	93.40%	1.17%	5.22%	A: 0.13%
Tropical Japonica	504	0.20%	91.50%	0.00%	8.33%	NA
Japonica Intermediate	241	1.70%	54.40%	0.00%	43.98%	NA
VI/Aromatic	96	60.40%	37.50%	0.00%	2.08%	NA
Intermediate	90	45.60%	45.60%	0.00%	7.78%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114889993	C -> G	LOC_Os01g26270.1	upstream_gene_variant ; 2883.0bp to feature; MODIFIER	silent_mutation	Average:35.737; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0114889993	C -> G	LOC_Os01g26250-LOC_Os01g26270	intergenic_region ; MODIFIER	silent_mutation	Average:35.737; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0114889993	C -> A	LOC_Os01g26270.1	upstream_gene_variant ; 2883.0bp to feature; MODIFIER	silent_mutation	Average:35.737; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0114889993	C -> A	LOC_Os01g26250-LOC_Os01g26270	intergenic_region ; MODIFIER	silent_mutation	Average:35.737; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0114889993	C -> DEL	N	N	silent_mutation	Average:35.737; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114889993	NA	3.18E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114889993	NA	6.18E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114889993	4.23E-06	NA	mr1383_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114889993	NA	1.23E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114889993	NA	8.17E-11	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251