Variant ID: vg0114524872 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 14524872 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, C: 0.33, others allele: 0.00, population size: 76. )
AATTAACTTAGAGCATTCTATAGAAGTAATTTAGTCAAATTTGAAAGTAACTTATATATATTATAAAAGTAACTTAGTATATAATAAAAGTAATTTACAA[C/A]
TATAAATATTTTTTCATTGTAATATAATCATGTAAGATCTTATTGTGAAGATTTAATTGTAACGAACATAATGGTGTAATTGGATTGTAAATCGGATAAG
CTTATCCGATTTACAATCCAATTACACCATTATGTTCGTTACAATTAAATCTTCACAATAAGATCTTACATGATTATATTACAATGAAAAAATATTTATA[G/T]
TTGTAAATTACTTTTATTATATACTAAGTTACTTTTATAATATATATAAGTTACTTTCAAATTTGACTAAATTACTTCTATAGAATGCTCTAAGTTAATT
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 79.80% | 15.20% | 0.23% | 4.85% | NA |
All Indica | 2759 | 68.30% | 23.20% | 0.40% | 8.08% | NA |
All Japonica | 1512 | 97.50% | 2.40% | 0.00% | 0.07% | NA |
Aus | 269 | 87.00% | 11.50% | 0.00% | 1.49% | NA |
Indica I | 595 | 80.50% | 14.50% | 0.34% | 4.71% | NA |
Indica II | 465 | 81.30% | 13.30% | 0.00% | 5.38% | NA |
Indica III | 913 | 55.20% | 36.00% | 0.55% | 8.21% | NA |
Indica Intermediate | 786 | 66.70% | 20.70% | 0.51% | 12.09% | NA |
Temperate Japonica | 767 | 98.70% | 1.20% | 0.00% | 0.13% | NA |
Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 7.80% | 0.00% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0114524872 | C -> A | LOC_Os01g25630.1 | downstream_gene_variant ; 1730.0bp to feature; MODIFIER | silent_mutation | Average:20.284; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0114524872 | C -> A | LOC_Os01g25610-LOC_Os01g25630 | intergenic_region ; MODIFIER | silent_mutation | Average:20.284; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg0114524872 | C -> DEL | N | N | silent_mutation | Average:20.284; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0114524872 | 1.40E-06 | 1.28E-10 | Grain_thickness | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0114524872 | NA | 4.61E-07 | Grain_weight | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0114524872 | NA | 5.03E-07 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114524872 | NA | 1.74E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |