\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114519177:

Variant ID: vg0114519177 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14519177
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.22, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGTTTTATGGTTTGGGAGAAATGGGCTCTAAAAATTGAACTTTGGATTAAATCTAGAAAATACGAAACAAAACTGTTTATGGGGCCAACCTGTCAAAC[A/G]
CTGTTATTCTTTTCTTTTCTCTCCTTCCTCCTCCCGATCACCTCTCTCTTTCTTGTTGCAGGCCGTGGCTAGGGTTGGGGATTCCAGCGGCTATGATGGC

Reverse complement sequence

GCCATCATAGCCGCTGGAATCCCCAACCCTAGCCACGGCCTGCAACAAGAAAGAGAGAGGTGATCGGGAGGAGGAAGGAGAGAAAAGAAAAGAATAACAG[T/C]
GTTTGACAGGTTGGCCCCATAAACAGTTTTGTTTCGTATTTTCTAGATTTAATCCAAAGTTCAATTTTTAGAGCCCATTTCTCCCAAACCATAAAACTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 45.40% 0.40% 4.27% NA
All Indica  2759 26.70% 65.60% 0.54% 7.18% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.07% NA
Aus  269 13.00% 86.20% 0.00% 0.74% NA
Indica I  595 15.80% 78.70% 0.50% 5.04% NA
Indica II  465 19.60% 77.40% 0.00% 3.01% NA
Indica III  913 37.70% 53.60% 0.55% 8.21% NA
Indica Intermediate  786 26.50% 62.60% 0.89% 10.05% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 64.60% 2.08% 0.00% NA
Intermediate  90 56.70% 41.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114519177 A -> G LOC_Os01g25610.1 downstream_gene_variant ; 3731.0bp to feature; MODIFIER silent_mutation Average:63.833; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0114519177 A -> G LOC_Os01g25610-LOC_Os01g25630 intergenic_region ; MODIFIER silent_mutation Average:63.833; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0114519177 A -> DEL N N silent_mutation Average:63.833; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114519177 NA 2.91E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114519177 NA 1.30E-06 Grain_weight Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114519177 NA 2.62E-07 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114519177 NA 3.67E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114519177 NA 1.42E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114519177 NA 4.47E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114519177 NA 2.86E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114519177 NA 1.58E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114519177 NA 2.46E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114519177 NA 4.12E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114519177 NA 3.06E-06 mr1043_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114519177 NA 6.03E-06 mr1269_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251