\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114410620:

Variant ID: vg0114410620 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14410620
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.40, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTATATTCGAATTATCACTATACACACTATTTAAATTTAAATCACGTCTACTTTTGTAAACTTATGTTTATATAAGCTTATGTTGTTTAAGCTATCTTAC[G/A]
CATTATTTTTACTCAATGTTCTCATAGTAAACTCCTGCATCAACTCGCGGGGTTTTACCTCGTATTACAATATGGATGCTACTAAAATTTTGTATAGCGA

Reverse complement sequence

TCGCTATACAAAATTTTAGTAGCATCCATATTGTAATACGAGGTAAAACCCCGCGAGTTGATGCAGGAGTTTACTATGAGAACATTGAGTAAAAATAATG[C/T]
GTAAGATAGCTTAAACAACATAAGCTTATATAAACATAAGTTTACAAAAGTAGACGTGATTTAAATTTAAATAGTGTGTATAGTGATAATTCGAATATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 35.50% 0.34% 9.86% NA
All Indica  2759 79.70% 4.20% 0.36% 15.73% NA
All Japonica  1512 2.80% 97.20% 0.00% 0.00% NA
Aus  269 97.80% 1.50% 0.00% 0.74% NA
Indica I  595 93.90% 0.30% 0.17% 5.55% NA
Indica II  465 82.80% 13.30% 0.22% 3.66% NA
Indica III  913 71.10% 1.40% 0.55% 26.94% NA
Indica Intermediate  786 77.10% 5.00% 0.38% 17.56% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 44.80% 5.21% 29.17% NA
Intermediate  90 47.80% 48.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114410620 G -> A LOC_Os01g25450.1 upstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:24.611; most accessible tissue: Minghui63 flag leaf, score: 32.882 N N N N
vg0114410620 G -> A LOC_Os01g25440-LOC_Os01g25450 intergenic_region ; MODIFIER silent_mutation Average:24.611; most accessible tissue: Minghui63 flag leaf, score: 32.882 N N N N
vg0114410620 G -> DEL N N silent_mutation Average:24.611; most accessible tissue: Minghui63 flag leaf, score: 32.882 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114410620 NA 5.13E-80 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 5.48E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 1.02E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 4.73E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 3.53E-69 mr1711 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 8.07E-06 mr1711 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 9.19E-25 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 1.81E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 4.70E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 2.38E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 1.31E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 1.31E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 3.21E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 7.04E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 8.26E-46 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 1.04E-45 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 6.90E-86 mr1711_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 5.21E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 8.22E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114410620 NA 7.03E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251