\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114354546:

Variant ID: vg0114354546 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14354546
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CATAAAGTATTAATCATGTTTTATCATCTCACAACAATAAAAATAATAATTATAAAAAAATTTCATATAAGACGGACAGTCAAATGTTAGACATGGAAAC[T/C,A]
CAGTGTTTGTCTTTTTTTAGACGGAGGGAGTAGATGTGTACTGTAAACAAATCGGTGAATACGGTGACTGGTGACCTGGAGTACTTTCCTGACAAGTGGT

Reverse complement sequence

ACCACTTGTCAGGAAAGTACTCCAGGTCACCAGTCACCGTATTCACCGATTTGTTTACAGTACACATCTACTCCCTCCGTCTAAAAAAAGACAAACACTG[A/G,T]
GTTTCCATGTCTAACATTTGACTGTCCGTCTTATATGAAATTTTTTTATAATTATTATTTTTATTGTTGTGAGATGATAAAACATGATTAATACTTTATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 46.50% 0.25% 0.44% A: 0.06%
All Indica  2759 83.80% 15.00% 0.36% 0.76% A: 0.11%
All Japonica  1512 0.10% 99.90% 0.00% 0.00% NA
Aus  269 32.30% 67.70% 0.00% 0.00% NA
Indica I  595 83.50% 15.50% 0.84% 0.17% NA
Indica II  465 94.80% 3.20% 0.00% 1.94% NA
Indica III  913 84.60% 14.50% 0.22% 0.44% A: 0.33%
Indica Intermediate  786 76.50% 22.30% 0.38% 0.89% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114354546 T -> A LOC_Os01g25386.1 intron_variant ; MODIFIER silent_mutation Average:80.121; most accessible tissue: Minghui63 flag leaf, score: 90.174 N N N N
vg0114354546 T -> DEL N N silent_mutation Average:80.121; most accessible tissue: Minghui63 flag leaf, score: 90.174 N N N N
vg0114354546 T -> C LOC_Os01g25386.1 intron_variant ; MODIFIER silent_mutation Average:80.121; most accessible tissue: Minghui63 flag leaf, score: 90.174 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0114354546 T A 0.0 0.01 0.02 0.01 0.01 -0.01
vg0114354546 T C -0.04 -0.03 -0.05 0.0 -0.07 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114354546 NA 9.31E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 1.86E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 8.31E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 9.79E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 4.00E-14 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 3.27E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 1.85E-11 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 7.95E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 6.78E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 5.51E-15 mr1581 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 5.13E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 4.43E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 2.92E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 6.53E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 5.45E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 9.27E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 1.41E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 1.02E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 5.56E-06 1.02E-07 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 1.39E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114354546 NA 2.34E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251