Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0114289141:

Variant ID: vg0114289141 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14289141
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAAAATATAAAAACGAATATGGTATGAGCATTATCCGTTCATATCCGTTCCGTTTTCATCTCTCCCTAAGAGGATCCTTTCCTCGGCTGTGTATTTGG[T/C]
GGCATCTACCTCCCTCAAGGATAATAGTAGAGCTCACATACTACTATTAGCCCATCTTAAAGCCAACATATAGTATAATAGATTAGCTATAAGGTTAGCT

Reverse complement sequence

AGCTAACCTTATAGCTAATCTATTATACTATATGTTGGCTTTAAGATGGGCTAATAGTAGTATGTGAGCTCTACTATTATCCTTGAGGGAGGTAGATGCC[A/G]
CCAAATACACAGCCGAGGAAAGGATCCTCTTAGGGAGAGATGAAAACGGAACGGATATGAACGGATAATGCTCATACCATATTCGTTTTTATATTTTTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.20%	30.70%	0.63%	34.43%	NA
All Indica	2759	1.80%	45.90%	1.05%	51.29%	NA
All Japonica	1512	97.20%	2.60%	0.00%	0.13%	NA
Aus	269	0.70%	32.30%	0.37%	66.54%	NA
Indica I	595	2.00%	41.20%	1.18%	55.63%	NA
Indica II	465	3.90%	24.10%	0.43%	71.61%	NA
Indica III	913	0.40%	62.20%	0.66%	36.69%	NA
Indica Intermediate	786	1.90%	43.40%	1.78%	52.93%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.00%	0.00%	0.20%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	53.10%	44.80%	0.00%	2.08%	NA
Intermediate	90	48.90%	18.90%	0.00%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114289141	T -> DEL	N	N	silent_mutation	Average:18.026; most accessible tissue: Callus, score: 46.198	N	N	N	N
vg0114289141	T -> C	LOC_Os01g25300.1	upstream_gene_variant ; 1232.0bp to feature; MODIFIER	silent_mutation	Average:18.026; most accessible tissue: Callus, score: 46.198	N	N	N	N
vg0114289141	T -> C	LOC_Os01g25290.1	downstream_gene_variant ; 2131.0bp to feature; MODIFIER	silent_mutation	Average:18.026; most accessible tissue: Callus, score: 46.198	N	N	N	N
vg0114289141	T -> C	LOC_Os01g25320.1	downstream_gene_variant ; 2926.0bp to feature; MODIFIER	silent_mutation	Average:18.026; most accessible tissue: Callus, score: 46.198	N	N	N	N
vg0114289141	T -> C	LOC_Os01g25290-LOC_Os01g25300	intergenic_region ; MODIFIER	silent_mutation	Average:18.026; most accessible tissue: Callus, score: 46.198	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114289141	NA	1.45E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289141	NA	1.09E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289141	NA	2.18E-28	mr1903	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289141	NA	1.55E-14	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289141	NA	8.92E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289141	NA	3.44E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289141	NA	8.85E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251