\
| Variant ID: vg0114248557 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14248557 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 111. )
CCTTTCTCCTCTCGACACTATACATCCTTTCCTAGTGTTGATGTTGTCCATGAGGGAAGGATCCAGTGAGCATAGTTGTGATACTGAGTAGACTCCTAGC[A/T]
GGGGAAGGTGCCGTCAGTGTGGTCCTGCTCGAAGTAGTTGTGGCGGCGCTCCGCGTCACTGCCGGCGAGGTATCGCATGCGGAGGCGCGTGATACCAAGC
GCTTGGTATCACGCGCCTCCGCATGCGATACCTCGCCGGCAGTGACGCGGAGCGCCGCCACAACTACTTCGAGCAGGACCACACTGACGGCACCTTCCCC[T/A]
GCTAGGAGTCTACTCAGTATCACAACTATGCTCACTGGATCCTTCCCTCATGGACAACATCAACACTAGGAAAGGATGTATAGTGTCGAGAGGAGAAAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 34.20% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 48.60% | 51.10% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 34.20% | 65.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 44.90% | 55.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 29.00% | 69.90% | 1.08% | 0.00% | NA |
| Indica III | 913 | 62.70% | 37.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114248557 | A -> T | LOC_Os01g25210.1 | upstream_gene_variant ; 2445.0bp to feature; MODIFIER | silent_mutation | Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0114248557 | A -> T | LOC_Os01g25230.1 | upstream_gene_variant ; 1658.0bp to feature; MODIFIER | silent_mutation | Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0114248557 | A -> T | LOC_Os01g25240.1 | upstream_gene_variant ; 4372.0bp to feature; MODIFIER | silent_mutation | Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0114248557 | A -> T | LOC_Os01g25220.1 | downstream_gene_variant ; 262.0bp to feature; MODIFIER | silent_mutation | Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0114248557 | A -> T | LOC_Os01g25220-LOC_Os01g25230 | intergenic_region ; MODIFIER | silent_mutation | Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114248557 | NA | 1.12E-07 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114248557 | NA | 5.54E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114248557 | 4.52E-06 | 4.41E-10 | mr1193 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114248557 | 4.94E-06 | 1.83E-07 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114248557 | NA | 2.62E-08 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114248557 | NA | 7.56E-09 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |