Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0114248557:

Variant ID: vg0114248557 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14248557
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTTCTCCTCTCGACACTATACATCCTTTCCTAGTGTTGATGTTGTCCATGAGGGAAGGATCCAGTGAGCATAGTTGTGATACTGAGTAGACTCCTAGC[A/T]
GGGGAAGGTGCCGTCAGTGTGGTCCTGCTCGAAGTAGTTGTGGCGGCGCTCCGCGTCACTGCCGGCGAGGTATCGCATGCGGAGGCGCGTGATACCAAGC

Reverse complement sequence

GCTTGGTATCACGCGCCTCCGCATGCGATACCTCGCCGGCAGTGACGCGGAGCGCCGCCACAACTACTTCGAGCAGGACCACACTGACGGCACCTTCCCC[T/A]
GCTAGGAGTCTACTCAGTATCACAACTATGCTCACTGGATCCTTCCCTCATGGACAACATCAACACTAGGAAAGGATGTATAGTGTCGAGAGGAGAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	34.20%	0.17%	0.00%	NA
All Indica	2759	48.60%	51.10%	0.25%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	34.20%	65.40%	0.37%	0.00%	NA
Indica I	595	44.90%	55.00%	0.17%	0.00%	NA
Indica II	465	29.00%	69.90%	1.08%	0.00%	NA
Indica III	913	62.70%	37.20%	0.11%	0.00%	NA
Indica Intermediate	786	46.70%	53.30%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114248557	A -> T	LOC_Os01g25210.1	upstream_gene_variant ; 2445.0bp to feature; MODIFIER	silent_mutation	Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0114248557	A -> T	LOC_Os01g25230.1	upstream_gene_variant ; 1658.0bp to feature; MODIFIER	silent_mutation	Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0114248557	A -> T	LOC_Os01g25240.1	upstream_gene_variant ; 4372.0bp to feature; MODIFIER	silent_mutation	Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0114248557	A -> T	LOC_Os01g25220.1	downstream_gene_variant ; 262.0bp to feature; MODIFIER	silent_mutation	Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0114248557	A -> T	LOC_Os01g25220-LOC_Os01g25230	intergenic_region ; MODIFIER	silent_mutation	Average:71.37; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114248557	NA	1.12E-07	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114248557	NA	5.54E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114248557	4.52E-06	4.41E-10	mr1193	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114248557	4.94E-06	1.83E-07	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114248557	NA	2.62E-08	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114248557	NA	7.56E-09	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251