\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114116382:

Variant ID: vg0114116382 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14116382
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAATTTGCTATGAAAAGAAGTAGCTCAACTTCCGTGAGCCTGATCCATTAAATTTGTGCTTTGCTTCCTCTTTACCCAAGCTAATGTAATGTGAATAG[A/G]
CCCATCTTGTTGGAATTCTACGTGAAACCCATTCCAGCAATCCAGTCCACGAAGGCTTCCTCTTGCGAGTCATCACGGCGGCGAGCGGGTGGCGGTGGCG

Reverse complement sequence

CGCCACCGCCACCCGCTCGCCGCCGTGATGACTCGCAAGAGGAAGCCTTCGTGGACTGGATTGCTGGAATGGGTTTCACGTAGAATTCCAACAAGATGGG[T/C]
CTATTCACATTACATTAGCTTGGGTAAAGAGGAAGCAAAGCACAAATTTAATGGATCAGGCTCACGGAAGTTGAGCTACTTCTTTTCATAGCAAATTCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 7.30% 1.90% 17.50% NA
All Indica  2759 64.20% 8.50% 1.78% 25.55% NA
All Japonica  1512 95.30% 4.60% 0.00% 0.13% NA
Aus  269 44.60% 1.10% 14.13% 40.15% NA
Indica I  595 29.60% 13.60% 1.68% 55.13% NA
Indica II  465 59.40% 13.30% 0.43% 26.88% NA
Indica III  913 93.30% 1.30% 1.10% 4.27% NA
Indica Intermediate  786 59.40% 10.10% 3.44% 27.10% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 89.30% 10.50% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 60.40% 38.50% 0.00% 1.04% NA
Intermediate  90 82.20% 2.20% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114116382 A -> G LOC_Os01g25020.1 downstream_gene_variant ; 2089.0bp to feature; MODIFIER silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0114116382 A -> G LOC_Os01g25030.1 downstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0114116382 A -> G LOC_Os01g25020-LOC_Os01g25030 intergenic_region ; MODIFIER silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0114116382 A -> DEL N N silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114116382 1.58E-06 1.33E-08 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116382 NA 6.07E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116382 NA 4.50E-08 mr1136 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116382 NA 2.02E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116382 NA 2.77E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116382 NA 5.89E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116382 2.79E-07 6.11E-09 mr1741 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116382 NA 3.29E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251