\
| Variant ID: vg0114116382 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14116382 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 45. )
CTGAATTTGCTATGAAAAGAAGTAGCTCAACTTCCGTGAGCCTGATCCATTAAATTTGTGCTTTGCTTCCTCTTTACCCAAGCTAATGTAATGTGAATAG[A/G]
CCCATCTTGTTGGAATTCTACGTGAAACCCATTCCAGCAATCCAGTCCACGAAGGCTTCCTCTTGCGAGTCATCACGGCGGCGAGCGGGTGGCGGTGGCG
CGCCACCGCCACCCGCTCGCCGCCGTGATGACTCGCAAGAGGAAGCCTTCGTGGACTGGATTGCTGGAATGGGTTTCACGTAGAATTCCAACAAGATGGG[T/C]
CTATTCACATTACATTAGCTTGGGTAAAGAGGAAGCAAAGCACAAATTTAATGGATCAGGCTCACGGAAGTTGAGCTACTTCTTTTCATAGCAAATTCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.30% | 7.30% | 1.90% | 17.50% | NA |
| All Indica | 2759 | 64.20% | 8.50% | 1.78% | 25.55% | NA |
| All Japonica | 1512 | 95.30% | 4.60% | 0.00% | 0.13% | NA |
| Aus | 269 | 44.60% | 1.10% | 14.13% | 40.15% | NA |
| Indica I | 595 | 29.60% | 13.60% | 1.68% | 55.13% | NA |
| Indica II | 465 | 59.40% | 13.30% | 0.43% | 26.88% | NA |
| Indica III | 913 | 93.30% | 1.30% | 1.10% | 4.27% | NA |
| Indica Intermediate | 786 | 59.40% | 10.10% | 3.44% | 27.10% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.30% | 10.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 60.40% | 38.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 82.20% | 2.20% | 3.33% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114116382 | A -> G | LOC_Os01g25020.1 | downstream_gene_variant ; 2089.0bp to feature; MODIFIER | silent_mutation | Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0114116382 | A -> G | LOC_Os01g25030.1 | downstream_gene_variant ; 616.0bp to feature; MODIFIER | silent_mutation | Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0114116382 | A -> G | LOC_Os01g25020-LOC_Os01g25030 | intergenic_region ; MODIFIER | silent_mutation | Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0114116382 | A -> DEL | N | N | silent_mutation | Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114116382 | 1.58E-06 | 1.33E-08 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114116382 | NA | 6.07E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114116382 | NA | 4.50E-08 | mr1136 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114116382 | NA | 2.02E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114116382 | NA | 2.77E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114116382 | NA | 5.89E-06 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114116382 | 2.79E-07 | 6.11E-09 | mr1741 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114116382 | NA | 3.29E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |