Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114116343:

Variant ID: vg0114116343 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14116343
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGACAGTATGCTCTATTGCTATACCAGAATCAAGAATCTGAATTTGCTATGAAAAGAAGTAGCTCAACTTCCGTGAGCCTGATCCATTAAATTTGTGC[T/A]
TTGCTTCCTCTTTACCCAAGCTAATGTAATGTGAATAGACCCATCTTGTTGGAATTCTACGTGAAACCCATTCCAGCAATCCAGTCCACGAAGGCTTCCT

Reverse complement sequence

AGGAAGCCTTCGTGGACTGGATTGCTGGAATGGGTTTCACGTAGAATTCCAACAAGATGGGTCTATTCACATTACATTAGCTTGGGTAAAGAGGAAGCAA[A/T]
GCACAAATTTAATGGATCAGGCTCACGGAAGTTGAGCTACTTCTTTTCATAGCAAATTCAGATTCTTGATTCTGGTATAGCAATAGAGCATACTGTCCAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.90%	11.90%	9.48%	5.73%	NA
All Indica	2759	61.50%	13.80%	15.30%	9.39%	NA
All Japonica	1512	99.90%	0.00%	0.13%	0.00%	NA
Aus	269	25.30%	64.70%	5.95%	4.09%	NA
Indica I	595	31.80%	19.80%	35.29%	13.11%	NA
Indica II	465	71.00%	11.20%	10.97%	6.88%	NA
Indica III	913	78.60%	6.40%	4.38%	10.62%	NA
Indica Intermediate	786	58.50%	19.50%	15.39%	6.62%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	6.70%	8.89%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114116343	T -> A	LOC_Os01g25020.1	downstream_gene_variant ; 2050.0bp to feature; MODIFIER	silent_mutation	Average:22.785; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0114116343	T -> A	LOC_Os01g25030.1	downstream_gene_variant ; 655.0bp to feature; MODIFIER	silent_mutation	Average:22.785; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0114116343	T -> A	LOC_Os01g25020-LOC_Os01g25030	intergenic_region ; MODIFIER	silent_mutation	Average:22.785; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0114116343	T -> DEL	N	N	silent_mutation	Average:22.785; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114116343	NA	2.36E-14	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	1.91E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	2.48E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	3.83E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	5.37E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	3.41E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	5.35E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	6.78E-07	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	1.58E-08	mr1193	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	2.07E-08	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	6.06E-07	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	2.49E-06	mr1208	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	1.76E-06	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	7.76E-10	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	1.61E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	8.17E-07	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	9.27E-07	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	6.28E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114116343	NA	3.17E-08	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251